Scamp5 (NM_001301634) Mouse Untagged Clone

CAT#: MC226471

Scamp5 (untagged) - Mouse secretory carrier membrane protein 5 (Scamp5), transcript variant 1



  "NM_001301634" in other vectors (1)

CNY 2,280.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Scamp5 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Sc; Sc5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226471 representing NM_001301634
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGAGAAAGTGAACAACTTCCCACCATTGCCCAAATTCATCCCACTGAAGCCATGTTTCTACCAAG
ACTTCGAGGCAGACATCCCTCCTCAGCATCTCAGCTTGACCAAGCGCCTCTACTACCTCTGGATGTTGAA
CAGCGTCACGCTGGCCGTGAACCTGGTGGGCTGTCTCGCGTGGCTGATCGGAGGCGGGGGAGCCACCAAC
TTTGGCCTGGCCTTTCTCTGGCTCATCCTCTTCACACCTTGCTCCTACGTCTGCTGGTTTCGGCCCATTT
ACAAGGCCTTCAAGACAGACAGTTCCTTCAGCTTCATGGCATTCTTCTTCACCTTCATGGCTCAGCTGGT
CATCAGCATCATCCAGGCTGTGGGAATTCCAGGCTGGGGTGTCTGCGGCTGGATTGCCACCATTTCCTTC
TTCGGGACGAACATCGGCTCAGCAGTGGTGATGCTCATTCCCACGGTCATGTTCACAGTTGTGGCCGTCT
TTTCCTTCATTGCTCTTAGCATGGTTCATAAGTTCTACCGGGGTAGCGGAGGCAGTTTCAGCAAGGCTCA
GGAGGAATGGACCACTGGAGCGTGGAAGAACCCACATGTGCAGCAGGCAGCCCAGAATGCAGCCATGGGG
GCTGCTCAGGGTGCCATGAATCAACCGCAGACTCAGTATTCTGCCACTCCCAACTACACGTACTCCAATG
AGATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301634
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301634.1, NP_001288563.1
RefSeq Size 3364 bp
RefSeq ORF 708 bp
Locus ID 56807
UniProt ID Q9JKD3
Gene Summary This gene encodes a member of the Scamp (secretory carrier membrane protein) family. The encoded protein may be involved in neuronal vesicle trafficking. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Both variants 1 and 2 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...