Klrk1 (NM_001286018) Mouse Untagged Clone

CAT#: MC226400

Klrk1 (untagged) - Mouse killer cell lectin-like receptor subfamily K, member 1 (Klrk1), transcript variant 3



  "NM_001286018" in other vectors (1)

CNY 2,190.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms D6H12S2489E; NKG2-D; Nkg2d
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226400 representing NM_001286018
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGCAAATGCCATAATTACGACCTCAAGCCAGCAAAGTGGGATACTTCTCAAGAACAACAGAAACAAA
GATTAGCACTAACTACCAGTCAACCTGGAGAAAATGGTATCATAAGAGGAAGATACCCTATAGAAAAACT
CAAAATATCTCCAATGTTCGTTGTTCGAGTCCTTGCTATAGCCTTGGCAATTCGATTCACCCTTAACACA
TTGATGTGGCTTGCCATTTTCAAAGAGACGTTTCAGCCAGTTATAATTATCTTGACAGTATTGTGCAACA
AGGAAGTCCCAGTTTCCTCAAGAGAGGGCTACTGTGGCCCATGCCCTAACAACTGGATATGTCACAGAAA
CAACTGTTACCAATTTTTTAATGAAGAGAAAACCTGGAACCAGAGCCAAGCTTCCTGTTTGTCTCAAAAT
TCCAGCCTTCTGAAGATATACAGTAAAGAAGAACAGGATTTCTTAAAGCTGGTTAAGTCCTATCACTGGA
TGGGACTGGTCCAGATCCCAGCAAATGGCTCCTGGCAGTGGGAAGATGGCTCCTCTCTCTCATACAATCA
GTTAACTCTGGTGGAAATACCAAAAGGATCCTGTGCTGTCTATGGCTCAAGCTTTAAGGCTTACACAGAA
GACTGTGCAAATCTAAACACGTACATCTGCATGAAAAGGGCGGTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286018
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286018.1, NP_001272947.1
RefSeq Size 3197 bp
RefSeq ORF 678 bp
Locus ID 27007
Gene Summary Function as an activating and costimulatory receptor involved in immunosurveillance upon binding to various cellular stress-inducible ligands displayed at the surface of autologous tumor cells and virus-infected cells. Provides both stimulatory and costimulatory innate immune responses on activated killer (NK) cells, leading to cytotoxic activity. Acts as a costimulatory receptor for T-cell receptor (TCR) in CD8(+) T-cell-mediated adaptive immune responses by amplifying T-cell activation. Stimulates perforin-mediated elimination of ligand-expressing tumor cells. Signaling involves calcium influx, culminating in the expression of TNF-alpha. Participates in NK cell-mediated bone marrow graft rejection. May play a regulatory role in differentiation and survival of NK cells. Binds to ligands belonging to various subfamilies of MHC class I-related glycoproteins including RAET1A, RAET1B, RAET1C, RAET1D, RAET1E, H60 and MULT1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and the 5' coding region and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform c, which contains a distinct N-terminus and an additional internal in-frame segment, and is shorter, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...