Cited1 (NM_001276473) Mouse Untagged Clone

CAT#: MC226277

Cited1 (untagged) - Mouse Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 (Cited1), transcript variant 3



  "NM_001276473" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI316840; AU019144; Msg1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226277 representing NM_001276473
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAACTATGTCGAGGCCTGCACTTGATGTCAAGGGTGGCACCACCTCTGGGAAGGAGGATGCCAACC
AGGAGATGAACTCTCTGGCCTACTCCAACCTTGGAGTGAAGGATCGCAAGGCAGTGACTGTCCTGCACTA
CCCCGGGGTCACCGCAAATGGAGCCAAAGCCAACGGAGTTCCCACTAGCTCCTCTGGATCGACATCTCCA
ATAGGCTCTCCTACTGCCACCCCTTCTTCCAAACCCCCATCCTTCAACCTGCATCCTACCCCTCACCTGA
TGGCCAGCATGCAGCTTCAGAAGCTTAATAGCCAGTACCAAGGGGCTGCGGCTACTGCTGCTGCTGCCCT
CACTGGTGCAGGCCTACCAGGGGAGGAAGAGCCCATGCAAAACTGGGTCACCGCCCCTCTGGTAGTGGGA
GGGTCTCCGGGATCTGTCTCTCCTCCTGCTGGTGCCCAGAGCCCTGCTCTCATTGATTCTGACCCGGTGG
ATGAGGAGGTGCTGATGTCTCTGGTGGTTGAATTGGGGCTAGACCGAGCCAATGAGCTTCCCGAGCTGTG
GCTGGGGCAGAATGAGTTTGATTTCACTGCAGATTTTCCCTCTGGCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276473
Insert Size 612 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276473.1, NP_001263402.1
RefSeq Size 773 bp
RefSeq ORF 612 bp
Locus ID 12705
UniProt ID P97769
Gene Summary Transcriptional coactivator of the p300/CBP-mediated transcription complex. Enhances SMAD-mediated transcription by strengthening the functional link between the DNA-binding SMAD transcription factors and the p300/CBP transcription coactivator complex. Stimulates estrogen-dependent transactivation activity mediated by estrogen receptors signaling; stabilizes the interaction of estrogen receptor ESR1 and histone acetyltransferase EP300. Positively regulates TGF-beta signaling through its association with the SMAD/p300/CBP-mediated transcriptional coactivator complex. Induces transcription from estrogen-responsive promoters and protection against cell death. Potentiates EGR2-mediated transcriptional activation activity from the ERBB2 promoter. Acts as an inhibitor of osteoblastic mineralization through a cAMP-dependent parathyroid hormone receptor signaling. May play a role in pigmentation of melanocytes. Associates with chromatin to the estrogen-responsive TGF-alpha promoter region in a estrogen-dependent manner.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2 and 3 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...