Galt (NM_001302511) Mouse Untagged Clone

CAT#: MC226275

Galt (untagged) - Mouse galactose-1-phosphate uridyl transferase (Galt), transcript variant 2



  "NM_001302511" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW553376
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226275 representing NM_001302511
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGGGCTGTTCTAACCCCCATCCCCACTGCCAGGTTTGGGCTAGCAGCTTCCTGCCAGATATCGCCC
AGCGTGAAGAGCGATCCCAGCAGACCTATCACAGCCAGCATGGAAAACCTTTGTTATTGGAATATGGTCA
CCAAGAGCTCCTCAGGAAGGAACGTCTGGTCCTAACCAGTGAGCACTGGATAGTTCTGGTCCCCTTCTGG
GCAGTGTGGCCTTTCCAGACACTTCTGCTGCCCCGGCGGCACGTGCGGCGGCTACCTGAGCTGAACCCCG
CTGAGCGTGATGATCTCGCCTCCATCATGAAGAAGCTCTTGACCAAGTACGACAATCTATTTGAGACATC
CTTTCCCTACTCCATGGGCTGGCATGGGGCTCCCACGGGATTAAAGACTGGAGCCACCTGTGACCACTGG
CAGCTCCACGCCCACTACTACCCCCCACTTCTGCGATCCGCAACTGTCCGGAAGTTCATGGTTGGCTATG
AAATGCTTGCCCAGGCCCAGCGTGACCTCACTCCCGAACAGGCCGCAGAAAGATTAAGGGCGCTTCCCGA
GGTACACTATTGCCTGGCGCAGAAAGACAAGGAAACGGCAGCCATTGCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302511
Insert Size 612 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302511.1, NP_001289440.1
RefSeq Size 1544 bp
RefSeq ORF 612 bp
Locus ID 14430
Gene Summary The protein encoded by this gene is the second enzyme in the Leloir pathway, the metabolic pathway for D-galactose catabolism. It catalyzes the conversion of galactose-1-phosphate and uridine diphosphate-glucose to glucose-1-phosphate and uridine diphosphate galactose. Deficiency of this enzyme causes the genetic metabolic disorder galactosemia. Mice lacking this protein accumulate high levels of galactose and galactose-1 phosphate but are viable and fertile. This protein is negatively regulated through signaling by the polypeptide hormone prolactin, specifically via the short isoform of the prolactin receptor and the transcription factor Forkhead box O3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) uses an alternate exon structure at the 5' end and utilizes a downstream start codon compared to variant 1. The resulting isoform (2) has a shorter N-terminus compared to isoform 1. Variants 2, 7, 8, and 9 all encode the same isoform (2). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...