Rbpms (NM_001042674) Mouse Untagged Clone

CAT#: MC226224

Rbpms (untagged) - Mouse RNA binding protein gene with multiple splicing (Rbpms), transcript variant 2



  "NM_001042674" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-RBPMS Antibody
    • 100 ul

CNY 5,325.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010300K22Rik; 2700019M19Rik; AU017537; hermes; RBP-MS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226224 representing NM_001042674
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACGGCGGCGGCAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGGTCC
GGACCCTATTTGTCAGCGGTCTGCCTCTGGACATCAAGCCCCGAGAGCTGTACCTGCTCTTCAGACCATT
CAAGGGCTATGAAGGTTCTCTCATAAAGCTCACATCTAAACAGCCCGTAGGCTTTGTCAGTTTTGACAGT
CGCTCAGAAGCAGAGGCCGCAAAGAACGCTTTGAACGGCATCCGCTTCGATCCTGAAATCCCGCAAACGC
TACGACTAGAGTTTGCTAAGGCAAACACGAAGATGGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAG
TACTCCTCTGCCCAACACTGTACCTCAGTTCATTGCCAGGGAGCCATATGAGCTCACAGTACCTGCACTT
TACCCCAGTAGCCCTGAAGTTTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCTGCTCTTCCTC
CTCCTGCCGCTTTCACCTACCCCGCTTCACTGCATGCCCAGATGCGCTGGATCCCTCCCTCCGAGGCCAC
TTCCCAGGGCTGGAAGTCCCGGCAGTTCTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001042674
Insert Size 594 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001042674.2, NP_001036139.1
RefSeq Size 2465 bp
RefSeq ORF 594 bp
Locus ID 19663
UniProt ID Q9WVB0
Gene Summary Acts as a coactivator of transcriptional activity. Required to increase TGFB1/Smad-mediated transactivation. Acts through SMAD2, SMAD3 and SMAD4 to increase transcriptional activity. Increases phosphorylation of SMAD2 and SMAD3 on their C-terminal SSXS motif, possibly through recruitment of TGFBR1. Promotes the nuclear accumulation of SMAD2, SMAD3 and SMAD4 proteins. Binds to poly(A) RNA.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' UTR, compared to variant 1. Variants 1 and 2 encode the same protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...