Rprd1b (NM_001291136) Mouse Untagged Clone

CAT#: MC226223

Rprd1b (untagged) - Mouse regulation of nuclear pre-mRNA domain containing 1B (Rprd1b), transcript variant 4



  "NM_001291136" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610304G08Rik; 2810446G03Rik; Crept
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226223 representing NM_001291136
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGACTCCAAGAGCCCTCCCCCCAAAGCAGAAGAGAAGAAGTCTCTAAAACGAACTTTTCAGCAGA
TACAAGAGGAGGAAGATGATGACTACCCTGGAAGCTACTCTCCCCAAGACCCTTCTGCAGGCCCTCTCTT
GACTGAGGAGTTAATCAAAGCTTTGCAGGATCTGGAAAATGCTGCGTCAGGGGATGCTACTGTCCGACAG
AAGATCGCTTCCCTGCCTCAGGAAGTGCAAGACGTGTCGCTGCTAGAGAAAATTACAGACAAAGAGGCAG
CTGAACGTCTTTCAAAAACAGTAGATGAAGCATGTCTGTTACTAGCGGAATATAACGGGCGCCTGGCAGC
GGAACTGGAAGACCGGCGCCAGCTGGCTCGGATGCTGGTGGAATACACCCAGAACCAGAAAGAGGTTTTG
TCAGAAAAAGAGAAAAAACTAGAAGAGTATAAACAGAAGCTTGCTCGAGTAACCCAGGTCCGCAAGGAAC
TCAAGTCCCACATTCAGAGCTTGCCAGACCTTTCGCTGTTGCCTAATGTCACAGGGGGCCTGGCACCTCT
GCCCTCTGCTGGTGACCTCTTTTCAACTGACTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291136
Insert Size 594 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291136.1, NP_001278065.1
RefSeq Size 4387 bp
RefSeq ORF 594 bp
Locus ID 70470
UniProt ID Q9CSU0
Gene Summary Interacts with phosphorylated C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit POLR2A, and participates in dephosphorylation of the CTD. Transcriptional regulator which enhances expression of CCND1. Promotes binding of RNA polymerase II to the CCDN1 promoter and to the termination region before the poly-A site but decreases its binding after the poly-A site. Prevents RNA polymerase II from reading through the 3' end termination site and may allow it to be recruited back to the promoter through promotion of the formation of a chromatin loop. Also enhances the transcription of a number of other cell cycle-related genes including CDK2, CDK4, CDK6 and cyclin-E but not CDKN1A, CDKN1B or cyclin-A. Promotes cell proliferation (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks an alternate exon in the 5' region, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, and it also uses an alternate in-frame splice site in the central coding region, compared to variant 1. The encoded isoform (d) is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...