Rnf138 (NM_001303011) Mouse Untagged Clone

CAT#: MC226177

Rnf138 (untagged) - Mouse ring finger protein 138 (Rnf138), transcript variant 4



  "NM_001303011" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
RNF138 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2410015A17Rik; 2810480D20Rik; STRIN; Trif; Trif-d
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226177 representing NM_001303011
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCGAGGAACTTTCGGCGGCCACGTCCTACACGGAAGATGATTTCTACTGCCCTGTCTGTCAGGAGG
TGCTCAAGACGCCGGTGCGGACCGCGGCCTGTCAGCACGTTTTCTGTAGAAAATGTTTCCTGACTGCAAT
GAGAGAAAGTGGAATACATTGTCCCCTATGTCGTGGAAGTGTGACTAGAAGAGAAAGAGCATGTCCGGAA
CGGGCCTTAGATCTTGAAAATATCATGAGGAGGTTTTCTGGTAGCTGCAGATGCTGTTCAAAAAAGATTA
AATTCTATCGCATGAGACATCATTACAAATCTTGTAAGAAGTATCAGGATGAATATGGTGTTTCTTCTGT
CATTCCAAACTTTAAGATTTCTCAAGATTCAGTAAGGAGCAGTTCTTCTGGGCATCCTACCTTTAAGTGT
CCCTTATGTCAAGAGTCAAATTTCACCAGACAACGTTTATTGGATCACTGTAATAGTAACCACCTATTTC
AGATAGTTCCTGTGAATCTTCAGCTAGATGAGGAAACCCAATATCAAACTGCTGTGGAAGAGTCTTTTCA
AGTAAACATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001303011
Insert Size 573 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001303011.1, NP_001289940.1
RefSeq Size 2746 bp
RefSeq ORF 573 bp
Locus ID 56515
UniProt ID Q9CQE0
Gene Summary E3 ubiquitin-protein ligase involved in DNA damage response by promoting DNA resection and homologous recombination. Recruited to sites of double-strand breaks following DNA damage and specifically promotes double-strand break repair via homologous recombination. Two different, non-exclusive, mechanisms have been proposed. According to a report, regulates the choice of double-strand break repair by favoring homologous recombination over non-homologous end joining (NHEJ): acts by mediating ubiquitination of XRCC5/Ku80, leading to remove the Ku complex from DNA breaks, thereby promoting homologous recombination. According to another report, cooperates with UBE2Ds E2 ubiquitin ligases (UBE2D1, UBE2D2, UBE2D3 or UBE2D4) to promote homologous recombination by mediating ubiquitination of RBBP8/CtIP. Together with NLK, involved in the ubiquitination and degradation of TCF/LEF. Also exhibits auto-ubiquitination activity in combination with UBE2K. May act as a negative regulator in the Wnt/beta-catenin-mediated signaling pathway.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks two alternate in-frame exons in the 3' coding region, compared to variant 1. The resulting protein (isoform 4) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...