Camk2a (NM_001286809) Mouse Untagged Clone

CAT#: MC226172

Camk2a (untagged) - Mouse calcium/calmodulin-dependent protein kinase II alpha (Camk2a), transcript variant 3



  "NM_001286809" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Anti-CaM Kinase II (Thr286) Antibody (Phospho-Specific)
    • 100 ul

CNY 5,643.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CaMKII; mKIAA0968; R74975
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226172 representing NM_001286809
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCTCTTTCTCACGCTGTGGGCCCTGGTGCCTTGCCTGGTGTTGCTAACCCTCTACTTTCTCTCCT
CCACAGGAGGGAAGAGCGGAGGAAACAAGAAGAACGATGGTGTGAAGGAATCTTCTGAGAGCACCAACAC
CACCATTGAGGACGAAGACACCAAAGTGCGCAAACAGGAAATTATCAAAGTGACAGAGCAGCTGATCGAA
GCCATAAGCAATGGAGACTTTGAGTCCTACACGAAGATGTGCGACCCTGGAATGACAGCCTTTGAACCAG
AGGCCCTGGGGAACCTGGTGGAGGGCCTGGACTTTCATCGATTCTATTTTGAAAACCTGTGGTCCCGGAA
CAGCAAGCCCGTGCACACCACCATCCTGAACCCTCACATCCACCTGATGGGTGACGAGTCAGCCTGCATC
GCCTATATCCGCATCACTCAGTACCTGGATGCAGGCGGCATACCCCGCACGGCCCAGTCAGAGGAGACCC
GCGTCTGGCACCGCAGGGACGGCAAATGGCAGATCGTCCACTTCCACAGATCTGGGGCGCCCTCCGTCCT
GCCGCATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286809
Insert Size 570 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286809.1, NP_001273738.1
RefSeq Size 4245 bp
RefSeq ORF 570 bp
Locus ID 12322
UniProt ID P11798
Gene Summary Calcium/calmodulin-dependent protein kinase that functions autonomously after Ca(2+)/calmodulin-binding and autophosphorylation, and is involved in synaptic plasticity, neurotransmitter release and long-term potentiation. Member of the NMDAR signaling complex in excitatory synapses, it regulates NMDAR-dependent potentiation of the AMPAR and therefore excitatory synaptic transmission (By similarity). Regulates dendritic spine development. Also regulates the migration of developing neurons (By similarity). Phosphorylates the transcription factor FOXO3 to activate its transcriptional activity (PubMed:23805378).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a significant portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 2. The resulting isoform (3) is shorter and has a distinct N-terminus, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...