Ndufv2 (NM_001278415) Mouse Untagged Clone

CAT#: MC225940

Ndufv2 (untagged) - Mouse NADH dehydrogenase (ubiquinone) flavoprotein 2 (Ndufv2), transcript variant 2



  "NM_001278415" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2900010C23Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225940 representing NM_001278415
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACAAGGTGGCTGAAGTTTTACAAGTACCTCCAATGAGAGTATATGAAGTAGCAACTTTTTATACAA
TGTATAATCGAAAGCCAGTTGGGAAGTACCATATCCAGGTCTGCACTACTACACCTTGCATGCTGCGAGA
TTCTGACAGCATATTGGAGACCCTTCAGAGAAAGCTTGGAATAAAGGTTGGAGAGACTACACCTGACAAA
CTTTTCACTCTTATAGAAGTGGAATGTTTAGGGGCCTGTGTAAATGCACCGATGGTTCAAATAAATGACA
ACTACTATGAGGATCTGACACCCAAGGATATTGAAGAGATTATTGATGAACTCAAAGCTGGAAAAGTTCC
CAAACCAGGGCCAAGGAGTGGCCGCTTCTGTTGTGAGCCAGCTGGAGGCCTTACTTCTTTGACTGAACCA
CCCAAAGGACCTGGCTTTGGTGTGCAAGCAGGCCTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001278415
Insert Size 459 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278415.1, NP_001265344.1
RefSeq Size 1637 bp
RefSeq ORF 459 bp
Locus ID 72900
UniProt ID Q9D6J6
Gene Summary This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. This gene is a core subunit and is conserved in prokaryotes and eukaryotes. The bovine ortholog of this protein has been characterized and is reported to contain an iron-sulfur cluster, which may be involved in electron transfer. In humans mutations in this gene are implicated in Parkinson's disease, bipolar disorder, schizophrenia, and have been found in one case of early onset hypertrophic cardiomyopathy and encephalopathy. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region and uses a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...