Cebpb (NM_001287739) Mouse Untagged Clone
CAT#: MC225908
Cebpb (untagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb), transcript variant 1
CNY 2,000.00
货期*
3周
规格
Product images
经常一起买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | C/EBPbeta; CRP2; IL-6DBP; LAP; LIP; NF-IL6; NF-M; Nfil6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225908 representing NM_001287739
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCCGGTTTCCCGTTCGCCCTGCGCGCCTACCTGGGCTACCAGGCGACGCCGAGCGGCAGCAGCG GCAGCCTGTCCACGTCGTCGTCGTCCAGCCCGCCCGGCACGCCGAGCCCCGCCGACGCCAAGGCCGCGCC CGCCGCCTGCTTCGCGGGGCCGCCGGCCGCGCCCGCCAAGGCCAAGGCCAAGAAGACGGTGGACAAGCTG AGCGACGAGTACAAGATGCGGCGCGAGCGCAACAACATCGCGGTGCGCAAGAGCCGCGACAAGGCCAAGA TGCGCAACCTGGAGACGCAGCACAAGGTGCTGGAGCTGACGGCGGAGAACGAGCGGCTGCAGAAGAAGGT GGAGCAGCTGTCGCGAGAGCTCAGCACCCTGCGGAACTTGTTCAAGCAGCTGCCCGAGCCGCTGCTGGCC TCGGCGGGCCACTGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001287739 |
Insert Size | 438 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001287739.1, NP_001274668.1 |
RefSeq Size | 1518 bp |
RefSeq ORF | 438 bp |
Locus ID | 12608 |
UniProt ID | P28033 |
Gene Summary | Important transcription factor regulating the expression of genes involved in immune and inflammatory responses (PubMed:16585579, PubMed:17911624, PubMed:18486321, PubMed:20111005). Plays also a significant role in adipogenesis, as well as in the gluconeogenic pathway, liver regeneration, and hematopoiesis (PubMed:9727068, PubMed:10635333, PubMed:17301242, PubMed:17601773, PubMed:19478079, PubMed:24061474, PubMed:24216764). The consensus recognition site is 5'-T[TG]NNGNAA[TG]-3'. Its functional capacity is governed by protein interactions and post-translational protein modifications. During early embryogenesis, plays essential and redundant functions with CEBPA (PubMed:15509779). Has a promitotic effect on many cell types such as hepatocytes and adipocytes but has an antiproliferative effect on T-cells by repressing MYC expression, facilitating differentiation along the T-helper 2 lineage (PubMed:9727068, PubMed:10635333, PubMed:16585579). Binds to regulatory regions of several acute-phase and cytokines genes and plays a role in the regulation of acute-phase reaction and inflammation. Plays also a role in intracellular bacteria killing (PubMed:17911624). During adipogenesis, is rapidly expressed and, after activation by phosphorylation, induces CEBPA and PPARG, which turn on the series of adipocyte genes that give rise to the adipocyte phenotype. The delayed transactivation of the CEBPA and PPARG genes by CEBPB appears necessary to allow mitotic clonal expansion and thereby progression of terminal differentiation (PubMed:15985551, PubMed:17301242, PubMed:17601773, PubMed:20194620). Essential for female reproduction because of a critical role in ovarian follicle development (PubMed:9303532). Restricts osteoclastogenesis (PubMed:19440205). Together with NFE2L1; represses expression of DSPP during odontoblast differentiation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes multiple isoforms through the use of alternative translation initiation codons. The isoform (c, also known as LIP) represented in this RefSeq results from translation initiation at the third in-frame AUG start codon. Isoform c has a shorter N-terminus, compared to isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228119 | Cebpb (myc-DDK-tagged) - Mouse CCAAT/enhancer binding protein (C/EBP), beta (Cebpb), transcript variant 1 |
CNY 1,900.00 |
Customer
Reviews
Loading...