Pla2g10 (NM_001291009) Mouse Untagged Clone

CAT#: MC225896

Pla2g10 (untagged) - Mouse phospholipase A2, group X (Pla2g10), transcript variant 2



  "NM_001291009" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms GX sPLA2; mGXs; PLA; PLA2GX; sPLA2-X
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225896 representing NM_001291009
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCTGCTACTGCTGCTGTTGCTGCTGGGACCTGGACCCGGATTCAGCGAAGCAACCAGGAGGTCAC
ATGTATACAAGCGTGGACTCCTGGAGCTGGCAGGGACCTTGGATTGTGTTGGGCCTCGATCTCCGATGGC
TTACATGAACTATGGCTGTTATTGTGGCCTTGGTGGCCATGGAGAGCCACGTGACGCCATTGACTGGTGC
TGCTACCACCACGACTGCTGCTACTCTCGGGCTCAGGACGCTGGCTGCAGCCCTAAGTTAGACCGCTACC
CATGGAAGTGCATGGACCATCACATCCTGTGTGGTGAGTGCCCTATGCCGTGTGACTTCCCCAAGTGCCC
ACTGGACATCCTGCAGATCCCAATGGCTCCTGTACCCTTGTGGACCAGCAGAGAACAAATGCCAAGAACT
TTTGTGCAGGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291009
Insert Size 435 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291009.2, NP_001277938.1
RefSeq Size 1005 bp
RefSeq ORF 435 bp
Locus ID 26565
Gene Summary This gene encodes a member of the phospholipase A2 family of lipolytic enzymes that hydrolyzes glycerophospholipids to produce free fatty acids and lysophospholipids. The encoded protein undergoes proteolytic processing to generate a calcium-dependent enzyme that plays pivotal roles in the liberation of arachidonic acid from membrane phospholipids leading to the production of various inflammatory lipid mediators, such as prostaglandins. In response to myocardial ischemia/reperfusion, mice lacking the encoded protein display a reduction in myocardial infarct size partly through the suppression of neutorphil cytotoxic activities. Alternative splicing results in multiple transcript variants encoding different isoforms. All of these isoforms may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2015]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...