Calprotectin (S100a9) (NM_001281852) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	60B8Ag; AW546964; BEE22; Cagb; GAGB; L1Ag; MRP14; p14
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225693 representing NM_001281852 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCAACAAAGCACCTTCTCAGATGGAGCGCAGCATAACCACCATCATCGACACCTTCCATCAATACT CTAGGAAGGAAGGACACCCTGACACCCTGAGCAAGAAGGAATTCAGACAAATGGTGGAAGCACAGTTGGC AACCTTTATGAAGAAAGAGAAGAGAAATGAAGCCCTCATAAATGACATCATGGAGGACCTGGACACAAAC CAGGACAATCAGCTGAGCTTTGAGGAGTGTATGATGCTGATGGCAAAGTTGATCTTTGCCTGTCATGAGA AGCTGCATGAGAACAACCCACGTGGGCATGGCCACAGTCATGGCAAAGGCTGTGGGAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001281852
Insert Size	342 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001281852.1, NP_001268781.1
RefSeq Size	537 bp
RefSeq ORF	342 bp
Locus ID	20202
UniProt ID	P31725
Gene Summary	S100A9 is a calcium- and zinc-binding protein which plays a prominent role in the regulation of inflammatory processes and immune response. It can induce neutrophil chemotaxis, adhesion, can increase the bactericidal activity of neutrophils by promoting phagocytosis via activation of SYK, PI3K/AKT, and ERK1/2 and can induce degranulation of neutrophils by a MAPK-dependent mechanism. Predominantly found as calprotectin (S100A8/A9) which has a wide plethora of intra- and extracellular functions. The intracellular functions include: facilitating leukocyte arachidonic acid trafficking and metabolism, modulation of the tubulin-dependent cytoskeleton during migration of phagocytes and activation of the neutrophilic NADPH-oxidase. Activates NADPH-oxidase by facilitating the enzyme complex assembly at the cell membrane, transferring arachidonic acid, an essential cofactor, to the enzyme complex and S100A8 contributes to the enzyme assembly by directly binding to NCF2/P67PHOX. The extracellular functions involve proinflammatory, antimicrobial, oxidant-scavenging and apoptosis-inducing activities. Its proinflammatory activity includes recruitment of leukocytes, promotion of cytokine and chemokine production, and regulation of leukocyte adhesion and migration. Acts as an alarmin or a danger associated molecular pattern (DAMP) molecule and stimulates innate immune cells via binding to pattern recognition receptors such as Toll-like receptor 4 (TLR4) and receptor for advanced glycation endproducts (AGER). Binding to TLR4 and AGER activates the MAP-kinase and NF-kappa-B signaling pathways resulting in the amplification of the proinflammatory cascade. Has antimicrobial activity towards bacteria and fungi and exerts its antimicrobial activity probably via chelation of Zn(2+) which is essential for microbial growth. Can induce cell death via autophagy and apoptosis and this occurs through the cross-talk of mitochondria and lysosomes via reactive oxygen species (ROS) and the process involves BNIP3. Can regulate neutrophil number and apoptosis by an anti-apoptotic effect; regulates cell survival via ITGAM/ITGB and TLR4 and a signaling mechanism involving MEK-ERK. Its role as an oxidant scavenger has a protective role in preventing exaggerated tissue damage by scavenging oxidants. The iNOS-S100A8/A9 transnitrosylase complex is proposed to direct selective inflammatory stimulus-dependent S-nitrosylation of multiple targets such as GAPDH, NXA5, EZR, MSN and VIM by recognizing a [IL]-x-C-x-x-[DE] motif (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.