Gzmm (NM_001302499) Mouse Untagged Clone

CAT#: MC225685

Gzmm (untagged) - Mouse granzyme M (lymphocyte met-ase 1) (Gzmm), transcript variant 3



  "NM_001302499" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Lmet; Lmet1; MMET-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225685 representing NM_001302499
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACCCACCAGGGTGGGCCCCGGGCCAGGGCCCTGCAGGAGTTGGATCTGCGTGTGCTGGATACCCAAA
TGTGTAACAACAGCCGCTTCTGGAACGGTGTCCTCATAGACAGCATGCTATGCTTAAAGGCTGGGAGCAA
GAGCCAAGCCCCCTGCAAGGGTGACTCTGGAGGGCCCCTGGTGTGTGGCAAAGGCCAGGTGGATGGGATC
CTGTCTTTCAGCTCCAAAACCTGCACAGACATCTTCAAGCCACCTGTGGCCACTGCTGTAGCCCCCTACA
GCTCCTGGATCAGGAAGGTCATTGGTCGCTGGTCACCCCAATCTTTGGTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302499
Insert Size 333 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302499.1, NP_001289428.1
RefSeq Size 815 bp
RefSeq ORF 333 bp
Locus ID 16904
Gene Summary The protein encoded by this gene is a member of a family of cytotoxic lymphocyte serine proteases called granzymes, which are expressed by cytotoxic T lymphocytes and natural killer cells. This protein belongs to a subfamily of granzymes that cleave after methionine residues. Natural killer cell development, homeostasis and cytotoxicity are normal in mice deficient for this gene, but they demonstrate increased susceptibility to murine cytomegalovirus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (3) contains a distinct 5' UTR, lacks exons in the coding region, and utilizes a downstream start codon compared to variant 1. It encodes isoform 3, which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...