Crkl (NM_001277231) Mouse Untagged Clone

CAT#: MC225678

Crkl (untagged) - Mouse v-crk sarcoma virus CT10 oncogene homolog (avian)-like (Crkl), transcript variant 2



  "NM_001277231" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110025F07Rik; AA589403; AI325100; Cr; Crkol; snoop
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225678 representing NM_001277231
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCTCCGCCAGGTTTGATTCTTCAGACCGCTCTGCCTGGTACATGGGGCCAGTGACTCGCCAGGAGG
CGCAGACTCGTCTCCAAGGCCAGCGCCATGGCATGTTCCTAGTCCGGGACTCATCTACCTGCCCCGGGGA
CTATGTACTGTCCGTGTCCGAGAACTCGCGTGTCTCGCACTACATCATCAACTCCCTGCCCAACCGCCGC
TTTAAGATCGGGGACCAGGAGTTTGACCATTTGCCGGCCTTGTTAGAGTTCTACAAGATCCACTACCTGG
ACACTACCACCTTAATCGAACCGGCGCCCAGGTTGGTGACATTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277231
Insert Size 327 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001277231.1, NP_001264160.1
RefSeq Size 4584 bp
RefSeq ORF 327 bp
Locus ID 12929
UniProt ID P47941
Gene Summary This gene is part of a family of adapter proteins that mediate formation of signal transduction complexes in response to extracellular stimuli, such as growth and differentiation factors. Protein-protein interactions occur through the SH2 domain, which binds phosphorylated tyrosine residues, and the SH3 domain, which binds proline-rich peptide motifs. These interactions promote recruitment and activation of effector proteins to regulate cell migration, adhesion, and proliferation. In certain mouse genetic backgrounds this protein is essential for embryonic development. It is important for neural crest cell differentiation and survival and is proposed to play an important role in transducing the oncogenic signal of Bcr/Abl. Deletion of this gene in mouse mimics the phenotype of DiGeorge/velocardiofacial syndrome in human. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...