Crkl (NM_001277231) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	1110025F07Rik; AA589403; AI325100; Cr; Crkol; snoop
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225678 representing NM_001277231 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCCTCCGCCAGGTTTGATTCTTCAGACCGCTCTGCCTGGTACATGGGGCCAGTGACTCGCCAGGAGG CGCAGACTCGTCTCCAAGGCCAGCGCCATGGCATGTTCCTAGTCCGGGACTCATCTACCTGCCCCGGGGA CTATGTACTGTCCGTGTCCGAGAACTCGCGTGTCTCGCACTACATCATCAACTCCCTGCCCAACCGCCGC TTTAAGATCGGGGACCAGGAGTTTGACCATTTGCCGGCCTTGTTAGAGTTCTACAAGATCCACTACCTGG ACACTACCACCTTAATCGAACCGGCGCCCAGGTTGGTGACATTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001277231
Insert Size	327 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001277231.1, NP_001264160.1
RefSeq Size	4584 bp
RefSeq ORF	327 bp
Locus ID	12929
UniProt ID	P47941
Gene Summary	This gene is part of a family of adapter proteins that mediate formation of signal transduction complexes in response to extracellular stimuli, such as growth and differentiation factors. Protein-protein interactions occur through the SH2 domain, which binds phosphorylated tyrosine residues, and the SH3 domain, which binds proline-rich peptide motifs. These interactions promote recruitment and activation of effector proteins to regulate cell migration, adhesion, and proliferation. In certain mouse genetic backgrounds this protein is essential for embryonic development. It is important for neural crest cell differentiation and survival and is proposed to play an important role in transducing the oncogenic signal of Bcr/Abl. Deletion of this gene in mouse mimics the phenotype of DiGeorge/velocardiofacial syndrome in human. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.