Cenpa (NM_001302130) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	Cen; Cenp-A
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225675 representing NM_001302130 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGGCTCTCAGACACTGCGCAGAAGACAGAAATTCATGTGGCTTAAGGAAATCAAGACCCTGCAGA AGAGCACAGACCTCTTGTTCAGGAAGAAGCCTTTCAGCATGGTTGTTAGAGAAATATGTGAGAAGTTCAG CCGTGGTGTGGATTTTTGGTGGCAAGCCCAGGCCTTGTTGGCCCTTCAGGAGGCAGCAGAAGCTTTCCTC ATCCACCTCTTTGAGGACGCCTACCTCCTCTCCTTACATGCTGGTCGGGTCACGCTTTTCCCCAAAGACA TTCAGTTGACCAGGAGAATCCGAGGCTTCGAGGGCGGACTCCCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001302130
Insert Size	327 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001302130.1, NP_001289059.1
RefSeq Size	1509 bp
RefSeq ORF	327 bp
Locus ID	12615
UniProt ID	O35216
Gene Summary	Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. This gene encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. Centromere protein A is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle. The protein is a replication-independent histone that is a member of the histone H3 family. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (3) contains two alternate exons in the 5' coding region and uses a downstream start codon compared to variant 1. The resulting isoform (2) has a distinct shorter N-terminus, compared to isoform 1. Variants 2, 3 and 4 encode the same isoform (2).

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.