Spink2 (NM_001289764) Mouse Untagged Clone

CAT#: MC225591

Spink2 (untagged) - Mouse serine peptidase inhibitor, Kazal type 2 (Spink2), transcript variant 1



  "NM_001289764" in other vectors (1)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal SPINK2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700007F22Rik; AV038945; HUSI-II
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225591 representing NM_001289764
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGTTCGTGCCGTGCCGTTACTGGCGGTTCTGCCCCGTGGAGAGTGGTGGCCATGGAAGCCTCTCATG
AGACTCTCGACTCTTCCGATTCTCAAATCATGAAGAGGTCACAGTTCCGAACACCAGACTGTGGTCATTT
TGACTTCCCAGCATGCCCTAGGAACCTCAACCCTGTGTGCGGAACGGATATGAACACTTACAGCAATGAA
TGTACCCTGTGCATGAAAATCAGGGAGGACGGTAGCCATATTAATATCATCAAAGACGAGCCATGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289764
Insert Size 279 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289764.1, NP_001276693.1
RefSeq Size 552 bp
RefSeq ORF 279 bp
Locus ID 69982
Gene Summary As a strong inhibitor of acrosin, it is required for normal spermiogenesis. It probably hinders premature activation of proacrosin and other proteases, thus preventing the cascade of events leading to spermiogenesis defects (PubMed:21705336, PubMed:28554943). May be involved in the regulation of serine protease-dependent germ cell apoptosis (PubMed:21705336). It also inhibits trypsin (PubMed:21705336).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...