Ghrl (NM_001286405) Mouse Untagged Clone

CAT#: MC225564

Ghrl (untagged) - Mouse ghrelin (Ghrl), transcript variant 3



  "NM_001286405" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti Ghrelin (ms, rt); neat antiserum
    • 50 ul

CNY 5,467.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2210006E23Rik; Gh; Ghr; m46; MT; MTLRP; MTLRPAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225564 representing NM_001286405
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGTCTTCAGGCACCATCTGCAGTTTGCTGCTACTCAGCATGCTCTGGATGGACATGGCCATGGCAG
GCTCCAGCTTCCTGAGCCCAGAGCACCAGAAAGCCCAGCAGAGAAAGGAATCCAAGAAGCCACCAGCTAA
ACTGCAGCCACGAGCTCTGGAAGGCTGGCTCCACCCAGAGGACAGAGGACAAGCAGAAGAGACAGAGGAG
GAGCTGGAGATCAGGAGGCGCCAGCTGACAAGTAACCACGGACAGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286405
Insert Size 261 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286405.1, NP_001273334.1
RefSeq Size 401 bp
RefSeq ORF 261 bp
Locus ID 58991
UniProt ID Q9EQX0
Gene Summary This gene encodes a preproprotein that undergoes proteolytic processing to yield two bioactive peptides, ghrelin and obestatin. The hormone ghrelin plays a role in enhancing appetite and has numerous other biological functions that include stimulating the secretion of growth hormone (somatotropin) from the anterior pituitary gland. Obestatin is thought to be a hormone that functions in decreasing appetite. Mice lacking the encoded protein develop normally and exhibit no gross anatomical abnormalities. This gene encodes distinct isoforms, some or all of which may undergo similar proteolytic processing. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an exon in the 3' coding region resulting in a frameshift, compared to variant 1. The encoded protein (isoform 3) is shorter than isoform 1 and has a distinct C-terminus. This isoform (3) may undergo proteolytic processing similar to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...