Rora (NM_001289917) Mouse Untagged Clone
CAT#: MC225531
Rora (untagged) - Mouse RAR-related orphan receptor alpha (Rora), transcript variant 3
CNY 2,000.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 9530021D13Rik; nmf267; Nr1f1; ROR1; ROR2; ROR3; sg; staggerer; tmgc26 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225531 representing NM_001289917
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTCAGCTCCGGCAGCCCCCGACCCCGCCGCCAGCGAACCGGGCAGCAGCGGCTCGGAGGCGGCCG CGGGCTCCAGGGAGACCCCGCTGACCCAGGACACGGGCCGCAAGAGCGAGGCACCGGGCGCGGGGCGCAG GCAGAGCTATGCGAGCTCCAGCCGAGGTGACTTTATAATCTCTAGGCACCGACATGTCTCGCTGAAGTCA AGGAAGGAGAACTCACAAGCTAAATTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001289917 |
Insert Size | 240 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001289917.1, NP_001276846.1 |
RefSeq Size | 1422 bp |
RefSeq ORF | 240 bp |
Locus ID | 19883 |
Gene Summary | The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014] Transcript Variant: This variant (3) differs in the 3' UTR and coding sequence and shares only the first exon compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227742 | Rora (myc-DDK-tagged) - Mouse RAR-related orphan receptor alpha (Rora), transcript variant 3 |
CNY 1,900.00 |
Customer
Reviews
Loading...