Gimap4 (NM_001243201) Mouse Untagged Clone
CAT#: MC225485
Gimap4 (untagged) - Mouse GTPase, IMAP family member 4 (Gimap4), transcript variant 5
CNY 2,000.00
货期*
3周
规格
Product images
经常一起买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AU019574; E430007K16Rik; I; Ian-1; Ian1; Imap4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225485 representing NM_001243201
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAAGTCCAGTGCGGTGGTGCGGGGTTCATCCCAGAAAGTTCAAGGAGCAGCCATGAGCTTGGAAACC AAGATCAAGGAATTCCCCAACTGAGAATTGTCTTACTTGGAAAAACTGGAGCAGGAAAGAGTTCAACAGG GAACATGCTCACCCCCCCCGATGCCCAAATGCTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243201 |
Insert Size | 177 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243201.1, NP_001230130.1 |
RefSeq Size | 906 bp |
RefSeq ORF | 177 bp |
Locus ID | 107526 |
Gene Summary | This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. This gene exists within a cluster of other related genes located on mouse chromosome 6. This family member encodes a lymphoid signaling protein that functions to accelerate programmed T-cell death, which appears to correlate with the phosphorylation status of the protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (5) lacks an alternate segment that spans both the central and 3' coding regions, and which results in a frameshift, compared to variant 1. The encoded isoform (e) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227696 | Gimap4 (myc-DDK-tagged) - Mouse GTPase, IMAP family member 4 (Gimap4), transcript variant 5 |
CNY 1,900.00 |
Customer
Reviews
Loading...