Apela (NM_001297554) Mouse Untagged Clone

CAT#: MC225483

Apela (untagged) - Mouse apelin receptor early endogenous ligand (Apela)



  "NM_001297554" in other vectors (1)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ela; Elabela; Ende; ENSMUSG00000074303; Gm10664
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225483 representing NM_001297554
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGATTCCAGCCCCTTTTTTGGGTATTTTTTATTTTTGCCATGAGTCTCCTTTTTATCAGTGAACAGA
AACCAGTTAACTTTCCCAGGAGAAGAAAACTATACAGACACAACTGCTTTCGCAGGAGATGCATTCCACT
TCATTCTCGAGTGCCCTTCCCATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001297554
Insert Size 165 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001297554.1, NP_001284483.1
RefSeq Size 990 bp
RefSeq ORF 165 bp
Locus ID 100038489
UniProt ID P0DMC4
Gene Summary Endogenous ligand for the apelin receptor (APLNR) (By similarity). Hormone required for mesendodermal differentiation, blood vessels formation and heart morphogenesis during early development and for adult cardiovascular homeostasis (PubMed:28371822, PubMed:28854362, PubMed:28890073, PubMed:28663440). Drives internalization of the APLNR (By similarity). Acts as a motogen by promoting mesendodermal cell migration during gastrulation by binding and activating APLNR (By similarity). Acts as an early embryonic regulator of cellular movement with a role in migration and development of cardiac progenitor cells (PubMed:28854362). May act as a chemoattractant for the activation of angioblast migration toward the embryonic midline, i.e. the position of the future vessel formation, during vasculogenesis (By similarity). Positively regulates sinus venosus (SV)-derived endothelial cells migration into the developing heart to promote coronary blood vessel sprouting (PubMed:28890073). Plays a role in placental vascular development; promotes placental trophoblast invasion and spiral artery remodeling in the uterus (PubMed:28663440). Involved in the regulation of maternal cardiovascular homeostasis to prevent gestational hypertension and for potent cardioprotective functions during heart failure (PubMed:28371822, PubMed:28663440). Mediates myocardial contractility in an ERK1/2-dependent manner (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...