Syk (NM_011518) Mouse Untagged Clone
CAT#: MC219893
Syk (untagged) - Mouse spleen tyrosine kinase (Sykb), transcript variant 1, (10ug)
CNY 8,080.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Sykb |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC219893 representing NM_011518
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGGAAGTGCTGTGGACAGCGCCAACCACCTGACCTACTTTTTTGGCAACATCACCCGGGAAGAGG CTGAAGACTACCTGGTCCAGGGAGGCATGACCGATGGGCTCTACCTGCTACGCCAGAGCCGCAATTACCT GGGTGGTTTTGCTTTGTCGGTGGCTCACAACAGGAAGGCACACCACTACACCATCGAGAGGGAACTTAAT GGCACCTACGCCATCTCCGGGGGCAGGGCCCATGCCAGCCCAGCAGACCTCTGCCATTACCACTCCCAGG AACCTGATGGCCTTATCTGCCTCCTTAAGAAGCCCTTCAACCGGCCCCCGGGAGTACAGCCCAAGACCGG ACCCTTTGAGGACCTGAAGGAGAACCTCATCAGGGAATATGTGAAACAGACCTGGAACCTTCAGGGCCAG GCTCTGGAGCAAGCCATCATCAGCCAGAAGCCCCAGCTGGAGAAGCTGATCGCCACCACGGCCCATGAGA AGATGCCCTGGTTCCATGGCAACATCTCCAGAGATGAATCAGAGCAGACGGTCCTCATAGGGTCAAAGAC CAATGGAAAATTCCTGATCAGGGCCAGAGACAACAGCGGCTCCTATGCTCTGTGCCTGCTGCACGAAGGG AAAGTATTGCACTACCGCATTGACAGGGACAAGACCGGGAAGCTCTCCATTCCTGAGGGGAAGAAGTTTG ACACCCTCTGGCAGCTAGTGGAACATTACTCTTACAAGCCAGATGGGCTACTAAGAGTCCTCACGGTACC ATGCCAAAAGATTGGTGCACAGATGGGCCACCCAGGAAGCCCAAATGCCCATCCCGTGACTTGGTCACCG GGTGGAATAATCTCAAGGATCAAATCCTACTCCTTCCCAAAGCCTGGCCACAAAAAGCCTGCCCCACCCC AAGGGAGCCGTCCAGAGAGCACTGTGTCCTTCAACCCCTATGAGCCAACGGGAGGGCCCTGGGGCCCAGA CAGAGGCCTTCAGAGAGAAGCCCTGCCCATGGACACAGAGGTGTACGAGAGCCCTTATGCTGACCCTGAA GAGATCCGGCCCAAAGAGGTCTACCTGGACAGGAGCCTGCTGACCCTGGAGGACAATGAACTGGGCTCCG GTAACTTCGGGACTGTGAAAAAGGGATACTACCAAATGAAAAAAGTTGTGAAAACCGTGGCTGTGAAAAT CCTGAAGAACGAGGCCAACGACCCGGCTTTGAAGGACGAGCTGCTGGCAGAGGCGAACGTCATGCAGCAG CTGGACAACCCCTACATTGTGCGCATGATCGGAATCTGCGAGGCGGAGTCCTGGATGCTGGTGATGGAGA TGGCGGAGCTGGGGCCGCTCAACAAGTACCTGCAGCAGAACAGGCACATTAAGGATAAGAACATCATAGA GCTGGTTCACCAGGTTTCCATGGGGATGAAGTATTTGGAAGAGAGCAACTTTGTGCACAGAGATCTGGCT GCGCGGAACGTGCTTCTGGTCACACAGCACTATGCCAAGATCAGCGATTTCGGTCTTTCCAAAGCCCTGC GTGCTGATGAAAACTACTACAAGGCCCAGACCCACGGGAAGTGGCCCGTGAAGTGGTACGCCCCCGAATG CATCAACTACTACAAGTTCTCCAGTAAGAGTGACGTCTGGAGCTTCGGAGTCCTGATGTGGGAAGCGTTC TCCTATGGGCAGAAGCCCTACAGAGGGATGAAAGGGAGCGAAGTGACCGCCATGCTGGAGAAAGGAGAGC GGATGGGGTGCCCTGCAGGATGCCCGAGAGAGATGTACGACCTGATGAACCTGTGCTGGACTTACGATGT GGAGAACAGGCCAGGATTCACAGCTGTGGAACTGAGGCTTCGCAATTACTACTACGACGTGGTTAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011518 |
Insert Size | 1890 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_011518.2, NP_035648.2 |
RefSeq Size | 5148 bp |
RefSeq ORF | 1890 bp |
Locus ID | 20963 |
UniProt ID | P48025 |
Gene Summary | Non-receptor tyrosine kinase which mediates signal transduction downstream of a variety of transmembrane receptors including classical immunoreceptors like the B-cell receptor (BCR). Regulates several biological processes including innate and adaptive immunity, cell adhesion, osteoclast maturation, platelet activation and vascular development. Assembles into signaling complexes with activated receptors at the plasma membrane via interaction between its SH2 domains and the receptor tyrosine-phosphorylated ITAM domains. The association with the receptor can also be indirect and mediated by adapter proteins containing ITAM or partial hemITAM domains. The phosphorylation of the ITAM domains is generally mediated by SRC subfamily kinases upon engagement of the receptor. More rarely signal transduction via SYK could be ITAM-independent. Direct downstream effectors phosphorylated by SYK include VAV1, PLCG1, PI-3-kinase, LCP2 and BLNK. Initially identified as essential in B-cell receptor (BCR) signaling, it is necessary for the maturation of B-cells most probably at the pro-B to pre-B transition. Activated upon BCR engagement, it phosphorylates and activates BLNK an adapter linking the activated BCR to downstream signaling adapters and effectors. It also phosphorylates and activates PLCG1 and the PKC signaling pathway. It also phosphorylates BTK and regulates its activity in B-cell antigen receptor (BCR)-coupled signaling. In addition to its function downstream of BCR plays also a role in T-cell receptor signaling. Plays also a crucial role in the innate immune response to fungal, bacterial and viral pathogens. It is for instance activated by the membrane lectin CLEC7A. Upon stimulation by fungal proteins, CLEC7A together with SYK activates immune cells inducing the production of ROS. Also activates the inflammasome and NF-kappa-B-mediated transcription of chemokines and cytokines in presence of pathogens. Regulates neutrophil degranulation and phagocytosis through activation of the MAPK signaling cascade. Required for the stimulation of neutrophil phagocytosis by IL15 (By similarity). Also mediates the activation of dendritic cells by cell necrosis stimuli. Also involved in mast cells activation. Involved in interleukin-3/IL3-mediated signaling pathway in basophils (PubMed:19098920). Also functions downstream of receptors mediating cell adhesion. Relays for instance, integrin-mediated neutrophils and macrophages activation and P-selectin receptor/SELPG-mediated recruitment of leukocytes to inflammatory loci. Plays also a role in non-immune processes. It is for instance involved in vascular development where it may regulate blood and lymphatic vascular separation. It is also required for osteoclast development and function. Functions in the activation of platelets by collagen, mediating PLCG2 phosphorylation and activation. May be coupled to the collagen receptor by the ITAM domain-containing FCER1G. Also activated by the membrane lectin CLEC1B that is required for activation of platelets by PDPN/podoplanin. Involved in platelet adhesion being activated by ITGB3 engaged by fibrinogen. Together with CEACAM20, enhances production of the cytokine CXCL8/IL-8 via the NFKB pathway and may thus have a role in the intestinal immune response (PubMed:26195794).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG209591 | Syk (tGFP-tagged) - Mouse spleen tyrosine kinase (Syk) |
CNY 6,288.00 |
|
MR209591 | Syk (Myc-DDK-tagged) - Mouse spleen tyrosine kinase (Sykb), transcript variant 1 |
CNY 4,688.00 |
|
MR209591L3 | Lenti ORF clone of Syk (Myc-DDK-tagged) - Mouse spleen tyrosine kinase (Sykb), transcript variant 1 |
CNY 6,460.00 |
|
MR209591L4 | Lenti ORF clone of Syk (mGFP-tagged) - Mouse spleen tyrosine kinase (Sykb), transcript variant 1 |
CNY 6,460.00 |