Atxn3 (NM_001167914) Mouse Untagged Clone

CAT#: MC218537

Atxn3 (untagged) - Mouse ataxin 3 (Atxn3), transcript variant 2, (10ug)



  "NM_001167914" in other vectors (3)

CNY 6,940.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2210008M02Rik; AI463012; AI647473; ataxin-3; ATX3; Mjd; MJD1; Sca3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218537 representing NM_001167914
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGTCCATCTTCCACGAGAAACAAGAAGGCTCACTTTGTGCTCAGCATTGCCTGAATAACCTATTGC
AAGGAGAGTATTTTAGCCCTGTGGAGCTATCCTCAATTGCACACCAGCTGGATGAAGAGGAGAGGCTGAG
AATGGCAGAAGGGGGAGTCACTAGTGAAGACTACCGCACATTTTTACAGCAGCCTTCTGGAAATATGGAT
GACAGCGGCTTTTTCTCTATTCAAGTTATAAGCAATGCTTTGAAAGTTTGGGGTTTAGAACTAATCCTGT
TCAACAGTCCAGAGTACCAGAGGCTCAGAATTGATCCTATAAACGAAAGATCCTTTATATGCAATTATAA
AGAACACTGGTTTACAGTTAGAAAATTAGGCAAGCAGTGGTTTAACTTGAATTCTCTGTTGACGGGTCCA
GAATTAATATCAGATACATACCTCGCACTATTCTTGGCTCAATTACAGCAAGAAGGTTATTCTATATTTG
TTGTTAAGGGTGATCTGCCAGATTGTGAAGCTGACCAACTTTTGCAGATGATCAAGGTCCAACAGATGCA
TCGACCAAAACTTATTGGAGAGGAACTTGCACATCTGAAAGAGCAGAGTGCCCTCAAAGCAGACCTGGAG
CGCGTCTTAGAAGCAGCTGATGGGTCGGGCATATTTGATGAAGATGAGGATGATTTACAGAGGGCTCTAG
CCATAAGTCGCCAGGAAATCGACATGGAGGATGAAGAAGCTGATCTCCGCAGGGCCATTCAGCTCAGTAT
GCAAGGTAGTTCCAGAAGTATGTGTGAAAATAGTCCACAGACATCAAGTCCAGATCTCTCTTCAGAAGAG
CTGCGGAGGAGACGAGAAGCCTACTTTGAAAAGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001167914
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001167914.1, NP_001161386.1
RefSeq Size 1032 bp
RefSeq ORF 876 bp
Locus ID 110616
Gene Summary Deubiquitinating enzyme involved in protein homeostasis maintenance, transcription, cytoskeleton regulation, myogenesis and degradation of misfolded chaperone substrates (By similarity). Binds long polyubiquitin chains and trims them, while it has weak or no activity against chains of 4 or less ubiquitins (By similarity). Involved in degradation of misfolded chaperone substrates via its interaction with STUB1/CHIP: recruited to monoubiquitinated STUB1/CHIP, and restricts the length of ubiquitin chain attached to STUB1/CHIP substrates and preventing further chain extension (PubMed:21855799). Interacts with key regulators of transcription and represses transcription: acts as a histone-binding protein that regulates transcription (By similarity). Regulates autophagy via the deubiquitination of 'Lys-402' of BECN1 leading to the stabilization of BECN1 (PubMed:28445460).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs at the 3' end compared to variant 1, resulting in an isoform (2) with a shorter C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...