Zbtb7b (NM_009565) Mouse Untagged Clone

CAT#: MC218276

Zbtb7b (untagged) - Mouse zinc finger and BTB domain containing 7B (Zbtb7b), (10ug)



  "NM_009565" in other vectors (4)

CNY 6,940.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms c-Krox; Thpok; Zfp67
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218276 representing NM_009565
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGAGCCCCGAGGATGACCTGATTGGAATCCCATTCCCAGACCACAGCAGCGAGCTCCTGAGCTGCC
TGAACGAGCAGCGCCAGCTGGGCCATCTGTGCGACCTCACCATCAGGACGCAGGGTCTTGAGTACCGCAC
CCACAGGGCTGTGCTGGCTGCCTGTAGCCACTACTTCAAGAAGCTCTTTACGGAGGGAGGAGGGGGAACC
GTGATGGGAACAGGGGGTGGTGGGACGGCTTCTGGGGGAGCAGGGGCCGGTGTGTGTGAGCTGGACTTTG
TAGGGCCAGAGGCCCTAGGTGCCCTGCTCGAGTTTGCTTACACAGCCACACTGACCACCAGCAGCGCCAA
TATGCCGGCTGTACTCCAAGCTGCTCGGCTACTGGAAATCCCGTGTGTCATCGCTGCTTGCATGGAGATT
CTACAAGGCAGTGGGCTGGAAGCCCCCAGCCCCGATGAGGATGACTGTGAGCGAGCCCGACAGTACCTGG
AGGCTTTTGCCACTGCCACCACCACAGCCTCAACCTCAGGAATGCCCAACGGTGAAGACAGCCCTCCACA
GGTGCCCCTCCTACCGCCGCCGCCACCGCCACCTCGACCTGTTGCCCGTCGCAGCCGCAAACCCCGGAAA
GCTTTTCTTCAAACCAAAGGGGCCCGAGCAAACCATCTGGTCCCTGAGGCACCCACAGTACTCACCCATC
CCTTGACCTACGAAGAAGAAGAGATGGTTGGTAGATTGGGTAACAGTGGGGGCAGTGGGCTCGGAGATAG
CTATAGTCCTCCTACAGGTGCCGCCTCACCTGCCGAGGGGCCCCTGAACTATGAAGTCTTTGAAGGTGAG
GAAGAAGAGGAGGAGATGGCATACCCCCCAGGCTACGGGCTAGCCCAGAGTAATGAGCCCTCGCTATCAC
CAGAGGAGCTGGGCTCAGATGAAGATCCCATCGACCCCGACCTGATGGCTTACCTAAGTTCGCTGCACCA
GGACGCCCTGACACCAGGCCTGGATGGCCAAGACAAGCTGGTGCGTAAACGCCGTTCACAGATGCCCCAA
GAGTGCCCAGTCTGTCACAAGATAATCCACGGGGCAGGCAAACTGCCTCGGCACATGAGGACCCACACTG
GTGAGAAGCCCTTTGCCTGTGAGGTCTGCGGCGTCCGCTTCACCAGGAATGACAAGCTGAAGATCCACAT
GCGGAAGCACACAGGAGAACGCCCCTACTCGTGCCCCCACTGCCCAGCCCGCTTCCTGCATAGCTACGAC
CTCAAGAACCACATGCACCTGCACACCGGGGACCGGCCCTATGAGTGCCACCTGTGCCACAAGGCCTTCG
CCAAGGAGGACCACCTGCAGCGCCATCTCAAGGGTCAGAACTGCCTGGAGGTGCGCACCCGAAGGCGCCG
CAAGGATGACGTGGCAGCCCCTCACTACCCACCGCCCTCGACCACCACCTCATCCCCTGCTGGCCTCGAC
CTTTCCAATGGCCACCTGGACACCTTCCACCTCTCTCTGGCTCGATTCTGGGAGCAGTCGGCCACCACGG
GACCCCCAGTCACTACACAAGGGCCCCCTGAGGAGGAGGAAGAGGAAGGGACACCCACCACACCACAGGC
CGAAGGTGCCATGGAGTCCTCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_009565
Insert Size 1635 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009565.4, NP_033591.2
RefSeq Size 3704 bp
RefSeq ORF 1635 bp
Locus ID 22724
UniProt ID Q64321
Gene Summary Transcription regulator that acts as a key regulator of lineage commitment of immature T-cell precursors. Exerts distinct biological functions in the mammary epithelial cells and T cells in a tissue-specific manner (PubMed:15729333, PubMed:29420538). Necessary and sufficient for commitment of CD4 lineage, while its absence causes CD8 commitment. Development of immature T-cell precursors (thymocytes) to either the CD4 helper or CD8 killer T-cell lineages correlates precisely with their T-cell receptor specificity for major histocompatibility complex class II or class I molecules, respectively. Cross-antagonism between ZBTB7B and CBF complexes are determinative to CD4 versus CD8 cell fate decision (PubMed:15729333, PubMed:24880459, PubMed:18258917, PubMed:23481257). Suppresses RUNX3 expression and imposes CD4+ lineage fate by inducing the SOCS suppressors of cytokine signaling. induces, as a transcriptional activator, SOCS genes expression which represses RUNX3 expression and promotes the CD4+ lineage fate (PubMed:24880459). During CD4 lineage commitment, associates with multiple sites at the CD8 locus, acting as a negative regulator of the CD8 promoter and enhancers by epigenetic silencing through the recruitment of class II histone deacetylases, such as HDAC4 and HDAC5, to these loci (PubMed:22730529). Regulates the development of IL17-producing CD1d-restricted naural killer (NK) T cells (PubMed:23105140). Also functions as an important metabolic regulator in the lactating mammary glands. Critical feed-forward regulator of insulin signaling in mammary gland lactation, directly regulates expression of insulin receptor substrate-1 (IRS-1) and insulin-induced Akt-mTOR-SREBP signaling (PubMed:29420538). Transcriptional repressor of the collagen COL1A1 and COL1A2 genes. May also function as a repressor of fibronectin and possibly other extracellular matrix genes (PubMed:7937772). Potent driver of brown fat development, thermogenesis and cold-induced beige fat formation (PubMed:28784777). Recruits the brown fat lncRNA 1 (Blnc1):HNRNPU ribonucleoprotein complex to activate thermogenic gene expression in brown and beige adipocytes (PubMed:28784777).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...