United States
Germany
Japan
United Kingdom
China
Morf4l1 (BC103783) Mouse Untagged Clone
CAT＃: MC218255
Morf4l1 (untagged) - Mouse mortality factor 4 like 1 (cDNA clone MGC:118047 IMAGE:6529024), (10ug)
CNY 6,940.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | TEG-189, MRG15, MORFRG15, mKIAA4002 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC103783
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGCCCAAGCAGGACCCTAAGCCGAAATTCCAGGAGGGCGAGCGAGTGCTGTGCTTTCATGGGCCTC TTCTCTATGAAGCAAAGTGTGTAAAGGTTGCCATAAAGGACAAACAAGTGAAATACTTCATCCATTACAG TGGCTGGAATAAAAATTGGGATGAATGGGTGCCAGAAAGCAGAGTACTCAAATACGTGGACACCAATTTG CAGAAACAGCGAGAACTTCAAAAGGCCAATCAGGAACAATATGCAGAGGGCAAGATGAGAGGGGCTGCTC CGGGGAAGAAGACATCCGGCCTGCAACAGAAAAATGTCGAAGTGAAAACAAAAAAGAACAAGCAGAAAAC ACCTGGAAATGGAGATGGTGGCAGTACCAGTGAGACACCTCAGCCTCCTAGGAAGAAGAGAGCCCGGGTA GATCCTACCGTTGAAAATGAAGAAACCTTCATGAACAGAGTTGAAGTTAAAGTGAAGATCCCTGAAGAGC TGAAACCCTGGCTTGTGGATGACTGGGACTTGATCACCAGACAGAAGCAGCTTTTTTATCTTCCTGCCAA GAAGAATGTGGATTCCATTTTGGAGGATTATGCAAATTATAAGAAGTCTCGAGGAAATACAGATAATAAA GAGTATGCTGTTAATGAGGTGGTGGCAGGCATAAAGGAGTACTTCAATGTCATGTTGGGCACTCAGCTCC TCTACAAGTTTGAGAGACCACAGTACGCTGAAATCCTCGCCGACCACCCGGATGCGCCCATGTCCCAGGT GTACGGAGCGCCACATTTGCTGAGATTATTTGTGCGAATTGGAGCGATGTTGGCCTACACGCCTCTAGAT GAGAAAAGCCTTGCTTTATTACTGAACTATCTACATGATTTTCTCAAGTACCTGGCGAAGAATTCTGCAA CCTTGTTCAGTGCCAGTGATTATGAAGTGGCCCCTCCTGAGTACCATCGGAAAGCCGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC103783 |
| Insert Size | 972 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC103783, AAI03784 |
| RefSeq Size | 1301 bp |
| RefSeq ORF | 971 bp |
| Locus ID | 21761 |
| Gene Summary | Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the mSin3A complex which acts to repress transcription by deacetylation of nucleosomal histones. Required for homologous recombination repair (HRR) and resistance to mitomycin C (MMC). Involved in the localization of PALB2, BRCA2 and RAD51, but not BRCA1, to DNA-damage foci (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204695 | Morf4l1 (tGFP-tagged) - Mouse mortality factor 4 like 1 (cDNA clone MGC:118047 IMAGE:6529024) |
CNY 4,370.00 |
|
| MR204695 | Morf4l1 (Myc-DDK-tagged) - Mouse mortality factor 4 like 1 (cDNA clone MGC:118047 IMAGE:6529024) |
CNY 3,600.00 |
|
| MR204695L1 | Lenti ORF clone of Morf4l1 (Myc-DDK-tagged) - Mouse mortality factor 4 like 1 (cDNA clone MGC:118047 IMAGE:6529024) |
CNY 6,000.00 |
|
| MR204695L2 | Lenti ORF clone of Morf4l1 (mGFP-tagged) - Mouse mortality factor 4 like 1 (cDNA clone MGC:118047 IMAGE:6529024) |
CNY 5,890.00 |
|
| MR204695L3 | Lenti ORF clone of Morf4l1 (Myc-DDK-tagged) - Mouse mortality factor 4 like 1 (cDNA clone MGC:118047 IMAGE:6529024) |
CNY 5,890.00 |
|
| MR204695L4 | Lenti ORF clone of Morf4l1 (mGFP-tagged) - Mouse mortality factor 4 like 1 (cDNA clone MGC:118047 IMAGE:6529024) |
CNY 5,890.00 |
其它Morf4l1产品
