Rab34 (NM_001159482) Mouse Untagged Clone

CAT#: MC218230

Rab34 (untagged) - Mouse RAB34, member of RAS oncogene family (Rab34), transcript variant 2, (10ug)



  "NM_001159482" in other vectors (3)

CNY 6,940.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI326479; Narr; Rah; Rah1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218230 representing NM_001159482
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAACATTCTGGCGCCCGTGCGGAGGGACCGCGTCCTGGCGGAGCTGCCCCAGTGCCTGAAGAAAGAGG
CCGCTTTGCACGTGCGCAAAGACTTCCACCCCCGCGTCACTTGCGCCTGCCAGGAGCACCGGACAGGCAC
CGTGGGATTTAAGATATCCAAGGTCATCGTTGTGGGAGACCTATCTGTGGGGAAGACCTGTCTCATTAAT
AGGTTCTGCAAAGACACCTTCGATAAGAATTACAAGGCTACCATCGGAGTGGATTTTGAGATGGAACGAT
TTGAAGTCTTGGGTGTCCCCTTCAGTCTCCAACTTTGGGACACGGCTGGTCAGGAAAGGTTCAAGTGCAT
TGCTTCCACCTACTACCGTGGAGCTCAAGCCATCATCATTGTCTTCAACCTGAATGACGTGGCATCCCTG
GAACACACCAAGCAGTGGCTCACTGATGCCCTCAAGGAGAACGACCCTTCCAACGTGCTCCTCTTCCTTG
TGGGTTCCAAGAAGGACCTGAGTACTCCTGCTCAGTATTCCCTAATGGAGAAGGATGCCCTCAAGGTGGC
CCAAGAGATTAAGGCCGAGTACTGGGCGGTGTCCTCCCTCACTGGTGAGAATGTCCGGGAATTCTTCTTC
CGTGTGGCAGCACTAACCTTTGAGGCCAATGTCCTGGCGGAGCTGGAGAAATCCGGGGCTCGGCACATTG
CAGATGTTGTTCGCATCAACAGCGATGACAAAAACCTGTACCTAACTGCCAGCAAGAAAAAGGCCACATG
TTGTCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001159482
Insert Size 780 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001159482.1, NP_001152954.1
RefSeq Size 1376 bp
RefSeq ORF 780 bp
Locus ID 19376
UniProt ID Q64008
Gene Summary Protein transport. Plays a role in the maturation of phagosomes that engulf pathogens, such as S.aureus and Mycobacterium. Plays a role in the fusion of phagosomes with lysosomes (By similarity). Involved in the redistribution of lysosomes to the peri-Golgi region (PubMed:12475955). Acts also as a positive regulator of hedgehog signaling and regulates ciliary function (PubMed:29290584).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) represents use of an alternate promoter and 5' UTR, compared to variant 1. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...