Brcc3 (NM_145956) Mouse Untagged Clone
CAT#: MC218080
Brcc3 (untagged) - Mouse BRCA1/BRCA2-containing complex, subunit 3 (Brcc3), transcript variant 2, (10ug)
CNY 6,940.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | C6.1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC218080 representing NM_145956
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGTGCAGGTGGTGCAAGCTGTGCAGGCGGTTCATCTTGAGTCTGACGCTTTCCTAGTTTGTCTCA ACCATGCTCTGAGCACAGAAAAGGAGGAAGTGATGGGTCTGTGTATAGGGGAGTTGAATGATGACATAAG GAGTGACTCCAAATTTACATACACTGGAACGGAAATGCGCACAGTCCAAGAAAAGATGGATACCATCAGA ATTGTTCATATCCATTCTGTCATCATCTTGCGGCGTTCTGACAAGAGAAAGGACCGTGTAGAAATTTCTC CAGAGCAGCTGTCTGCAGCTTCAACAGAGGCAGAAAGGTTGGCTGAACTAACAGGTCGTCCCATGAGAGT TGTTGGCTGGTATCATTCCCACCCTCATATAACTGTTTGGCCTTCACATGTTGATGTTCGTACACAAGCC ATGTACCAAATGATGGATCAAGGCTTTGTAGGACTTATTTTTTCCTGTTTCATAGAAGACAAAAACACAA AGACTGGCCGGGTACTCTATACTTGCTTCCAATCCATACAAGCCCAAAAAAGCTCAGAGTATGAGAGAAT TGAAATCCCAATCCATATTGTACCTCATATCACTATTGGGAAAGTATGCCTTGAATCTGCAGTAGAGCTG CCAAAAATCCTGTGTCAGGAAGAACAGGATGCATATAGAAGGATTCACAGCCTTACACATCTGGACTCAG TGACCAAGATCCATAATGGCTCAGTATTTACCAAGAATTTGTGCAGTCAGATGTCAGCAGTCAGTGGGCC TCTACTGCAGTGGTTGGAAGACAGATTGGAGCAAAACCAGCAGCATTTGCAGGAGTTGCAACAAGAAAAG GAAGAGCTTATGGAAGAGCTGTCTTCCCTAGAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_145956 |
Insert Size | 876 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_145956.4, NP_666068.1 |
RefSeq Size | 4335 bp |
RefSeq ORF | 876 bp |
Locus ID | 210766 |
UniProt ID | P46737 |
Gene Summary | Metalloprotease that specifically cleaves 'Lys-63'-linked polyubiquitin chains. Does not have activity toward 'Lys-48'-linked polyubiquitin chains. Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). In the BRCA1-A complex, it specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX, antagonizing the RNF8-dependent ubiquitination at double-strand breaks (DSBs). Catalytic subunit of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin in various substrates. Mediates the specific 'Lys-63'-specific deubiquitination associated with the COP9 signalosome complex (CSN), via the interaction of the BRISC complex with the CSN complex. The BRISC complex is required for normal mitotic spindle assembly and microtubule attachment to kinetochores via its role in deubiquitinating NUMA1. Plays a role in interferon signaling via its role in the deubiquitination of the interferon receptor IFNAR1; deubiquitination increases IFNAR1 activity by enhancing its stability and cell surface expression. Down-regulates the response to bacterial lipopolysaccharide (LPS) via its role in IFNAR1 deubiquitination.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC204038 | Brcc3 (untagged) - Mouse BRCA1/BRCA2-containing complex, subunit 3 (Brcc3), transcript variant 2, (10ug) |
CNY 2,400.00 |
|
MG203983 | Brcc3 (tGFP-tagged) - Mouse BRCA1/BRCA2-containing complex, subunit 3 (Brcc3) |
CNY 2,850.00 |
|
MG223317 | Brcc3 (tGFP-tagged) - Mouse BRCA1/BRCA2-containing complex subunit 3 (Brcc3) transcript variant 2, (10ug) |
CNY 2,850.00 |
|
MR223317 | Brcc3 (Myc-DDK-tagged) - Mouse BRCA1/BRCA2-containing complex, subunit 3 (Brcc3), transcript variant 2 |
CNY 2,400.00 |
|
MR223317L3 | Lenti ORF clone of Brcc3 (Myc-DDK-tagged) - Mouse BRCA1/BRCA2-containing complex, subunit 3 (Brcc3), transcript variant 2 |
CNY 4,750.00 |
|
MR223317L4 | Lenti ORF clone of Brcc3 (mGFP-tagged) - Mouse BRCA1/BRCA2-containing complex, subunit 3 (Brcc3), transcript variant 2 |
CNY 4,750.00 |