Asah3l (BC059819) Mouse Untagged Clone
CAT#: MC218013
Asah3l (untagged) - Mouse N-acylsphingosine amidohydrolase 3-like (cDNA clone MGC:69583 IMAGE:6839525), (10ug)
CNY 6,940.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CRG-L1, Acer2, maCER2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC059819
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCGCCCCGCACTGGTGGGACCACCTGCGGGCTGGCAGTTCGGAGGTGGATTGGTGCGAGGACAACT ACACTATCGTGCCTGCCATTGCCGAGTTCTACAACACGATCAGCAACGTCTTGTTTTTCATTTTACCTCC CATCTGCATGTGCTTGTTCCGCCAGTACGCAACGTGCTTCAACAGCGGCATCTACTTAATATGGACGCTC CTAGTTGTAGTGGGGATTGGATCTGTCTACTTCCATGCAACGCTGAGTTTCCTGGGTCAGATGCTTGATG AACTTGCCATTCTGTGGGTTCTGATGTGTGCTTTGGCCATGTGGTTTCCCAGGAGGTATTTACCAAAGAT CTTTCGGAATGACAGGTGTGACAATGTGCGTGTGTTTAAGCTGGGCCTCTTCTCTGGCCTCTGGTGGACT CTGGCTCTCTTCTGCTGGATCAGCGACCAAGCCTTCTGTGAGCTGCTCTCCTCCTTTCACTTCCCCTACC TGCACTGTGTGTGGCATATTCTCATCTGCCTTGCTTCGTACCTGGGCTGTGTGTGCTTCGCCTACTTTGA TGCTGCCTCAGAGATACCTGAGCAAGGTCCAGTCATCAGATTCTGGCCCAGCGAGAAATGGGCTTTTATT GGTGTCCCTTATGTGTCCCTTCTGTGTGCCCACAAGAAGTCGCCAGTCAAGATCACGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC059819 |
Insert Size | 690 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC059819, AAH59819 |
RefSeq Size | 4078 bp |
RefSeq ORF | 689 bp |
Locus ID | 230379 |
Gene Summary | Golgi ceramidase that catalyzes the hydrolysis of ceramides into sphingoid bases like sphingosine and free fatty acids at alkaline pH (PubMed:29401619). Ceramides, sphingosine, and its phosphorylated form sphingosine-1-phosphate are bioactive lipids that mediate cellular signaling pathways regulating several biological processes including cell proliferation, apoptosis and differentiation (PubMed:29401619). Has a better catalytic efficiency towards unsaturated long-chain ceramides, including C18:1-, C20:1- and C24:1-ceramides (By similarity) (PubMed:29401619). Saturated long-chain ceramides and unsaturated very long-chain ceramides are also good substrates, whereas saturated very long-chain ceramides and short-chain ceramides are poor substrates. Also hydrolyzes dihydroceramides to produce dihydrosphingosine (By similarity). It is the ceramidase that controls the levels of circulating sphingosine-1-phosphate and dihydrosphingosine-1-phosphate in plasma through their production by hematopoietic cells (PubMed:29401619). Regulates cell proliferation, autophagy and apoptosis by the production of sphingosine and sphingosine-1-phosphate. As part of a p53/TP53-dependent pathway, promotes for instance autophagy and apoptosis in response to DNA damage. Through the production of sphingosine, may also regulate the function of the Golgi complex and regulate the glycosylation of proteins (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202750 | Asah3l (tGFP-tagged) - Mouse N-acylsphingosine amidohydrolase 3-like (cDNA clone MGC:69583 IMAGE:6839525) |
CNY 2,850.00 |
|
MR202750 | Asah3l (Myc-DDK-tagged) - Mouse N-acylsphingosine amidohydrolase 3-like (cDNA clone MGC:69583 IMAGE:6839525) |
CNY 2,400.00 |
|
MR202750L3 | Lenti ORF clone of Asah3l (Myc-DDK-tagged) - Mouse N-acylsphingosine amidohydrolase 3-like (cDNA clone MGC:69583 IMAGE:6839525) |
CNY 4,750.00 |
|
MR202750L4 | Lenti ORF clone of Asah3l (mGFP-tagged) - Mouse N-acylsphingosine amidohydrolase 3-like (cDNA clone MGC:69583 IMAGE:6839525) |
CNY 4,750.00 |