Tead1 (NM_001166585) Mouse Untagged Clone

CAT#: MC217754

Tead1 (untagged) - Mouse TEA domain family member 1 (Tead1), transcript variant 3, (10ug)



  "NM_001166585" in other vectors (3)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610024B07Rik; B230114H05Rik; Gtrgeo5; mTEF-1; Tcf13; TEAD-1; TEF-1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217754 representing NM_001166585
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAAAGGATGAGCGACTCGGCAGATAAGCCGATTGACAACGACGCGGAGGGCGTCTGGAGTCCTGATA
TTGAGCAGAGTTTCCAGGAGGCCCTGGCTATCTATCCGCCGTGTGGGAGGAGAAAAATCATCTTATCAGA
CGAAGGCAAAATGTATGGTAGAAATGAATTGATAGCCAGATACATCAAACTCAGGACGGGAAAGACAAGG
ACCAGGAAGCAGGTGTCTAGTCACATTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGC
TGAAGGATCAGACTGCCAAGGACAAGGCCCTGCAGCACATGGCTGCCATGTCATCAGCCCAGATCGTCTC
GGCTACTGCCATCCACAACAAGCTGGGGCTGCCTGGGATTCCACGCCCCACCTTCCCGGGGGGTCCGGGG
TTCTGGCCTGGGATGATACAGACAGGACAGCCAGGATCCTCACAAGACGTCAAGCCCTTTGTGCAGCAGG
CCTACCCCATCCAGCCAGCAGTCACAGCCCCCATTCCAGGGTTTGAGCCTACGTCAGCCCCAGCCCCCTC
AGTTCCTGCCTGGCAGGGCCGATCCATTGGCACAACCAAGCTTCGCCTGGTGGAATTCTCCGCTTTCCTT
GAACAGCAGAGAGACCCAGACTCGTACAACAAACACCTCTTCGTGCACATCGGGCATGCCAACCATTCTT
ACAGTGACCCGTTGCTCGAATCTGTGGACATTCGTCAGATATATGACAAATTTCCTGAAAAGAAAGGTGG
CTTGAAGGAGCTGTTTGGAAAGGGCCCTCAAAACGCCTTCTTCCTCGTCAAATTCTGGGCGGACTTAAAC
TGCAATATCCAAGACGACGCCGGGGCCTTTTATGGTGTGAGCAGTCAGTATGAGAGTTCTGAGAACATGA
CAGTTACCTGTTCCACCAAAGTGTGCTCCTTTGGGAAACAAGTAGTAGAAAAAGTAGAGACGGAGTATGC
GAGGTTCGAGAATGGTCGATTCGTGTACCGAATAAACCGCTCGCCAATGTGTGAATATATGATCAACTTC
ATCCACAAGCTCAAACACCTACCAGAGAAATATATGATGAACAGTGTTTTGGAAAACTTCACCATATTAT
TGGTGGTAACAAACAGGGATACACAAGAAACTCTGCTCTGCATGGCCTGTGTATTTGAAGTCTCGAATAG
CGAACACGGAGCACAGCACCATATCTACAGGCTTGTGAAGGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001166585
Insert Size 1236 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166585.1, NP_001160057.1
RefSeq Size 9480 bp
RefSeq ORF 1236 bp
Locus ID 21676
Gene Summary Transcription factor which plays a key role in the Hippo signaling pathway, a pathway involved in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein MST1/MST2, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Acts by mediating gene expression of YAP1 and WWTR1/TAZ, thereby regulating cell proliferation, migration and epithelial mesenchymal transition (EMT) induction. Binds specifically and cooperatively to the SPH and GT-IIC 'enhansons' (5'-GTGGAATGT-3') and activates transcription in vivo in a cell-specific manner. The activation function appears to be mediated by a limiting cell-specific transcriptional intermediary factor (TIF). Involved in cardiac development. Binds to the M-CAT motif (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks two alternate in-frame exons in the 5' coding region compared to variant 1 and uses a non-AUG (AUU) start codon for translation initiation. The resulting isoform (3) lacks two internal protein segments compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...