Aurka (BC005425) Mouse Untagged Clone

CAT#: MC217751

Aurka (untagged) - Mouse aurora kinase A (cDNA clone MGC:5804 IMAGE:3590706), (10ug)



  "BC005425" in other vectors (4)

CNY 6,940.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms IAK, Ark1, Ayk1, AIRK1, Aurora-A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005425
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACAGATGTAAAGAAAACTGTGTCTCCAGGCCTGTTAAGACCACTGTTCCCTTCGGTCCGAAACGCG
TCTTGGTGACTGAGCAGATTCCGTCTCAGAACCTAGGATCTGCTAGCAGTGGCCAGGCCCAGCGGGTCCT
GTGTCCTTCTAACTCTCAGCGTGTCCCTTCACAAGCCCAGAAACTTGGAGCAGGTCAGAAGCCGGCACCA
AAGCAGTTGCCAGCTGCCAGTGTTCCTCGGCCTGTGTCCCGGCTCAATAACCCCCAGAAGAATGAGCAGC
CTGCAGCCTCCGGAAATGATTCTGAAAAGGAGCAGGCATCCTTGCAGAAGACCGAAGACACAAAAAAAAG
GCAGTGGACTTTGGAAGATTTTGACATTGGCCGCCCACTAGGAAAAGGGAAGTTTGGAAATGTCTACTTG
GCGCGGGAGAGACAAAGCAAGTTCATCCTGGCTCTGAAGGTGCTGTTTAAAACACAGCTGGAGAAGGCGA
ACGTGGAGCACCAGCTTCGGAGAGAGGTGGAGATCCAGTCGCACCTGCGGCACCCCAACATCCTCAGGCT
GTATGGCTATTTCCATGACGCCACCCGAGTTTATCTGATTCTAGAATATGCGCCCCTTGGAACAGTCTAT
AGAGAGCTCCAAAAACTCTCCAAGTTTGACGAGCAGAGAACAGCTACTTACATCACTGAGTTGGCAAACG
CTCTGTCTTACTGTCATTCAAAGAGAGTGATCCACAGAGACATTAAGCCAGAGAACTTACTGCTTGGCTC
AAACGGAGAGTTGAAGATTGCAGACTTCGGGTGGTCGGTGCATGCTCCATCTTCCAGGAGAACCACAATG
TGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAAGGCCGGATGCATGACGAGAAGGTGGACCTCT
GGAGCCTGGGCGTTCTCTGCTATGAGTTCCTAGTGGGGATGCCTCCTTTCGAGGCACACACGTACCAGGA
GACTTACAGAAGGATATCTCGGGTTGAATTCACTTTCCCTGACTTTGTGACAGAGGGAGCCAGGGACCTC
ATTTCAAGACTGTTAAAACACAACGCAAGCCAAAGGCTAACACTAGCGGAAGTCCTTGAGCACCCTTGGA
TCAAAGCTAATTCTTCCAAACCTCCAACTGGCCACACTAGCAAAGAGCCAACCAGCAAATCATCTTAG


ACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACA
AGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-NotI     
ACCN BC005425
Insert Size 1188 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC005425, AAH05425
RefSeq Size 1850 bp
RefSeq ORF 1187 bp
Locus ID 20878
Gene Summary Mitotic serine/threonine kinase that contributes to the regulation of cell cycle progression. Associates with the centrosome and the spindle microtubules during mitosis and plays a critical role in various mitotic events including the establishment of mitotic spindle, centrosome duplication, centrosome separation as well as maturation, chromosomal alignment, spindle assembly checkpoint, and cytokinesis. Required for normal spindle positioning during mitosis and for the localization of NUMA1 and DCTN1 to the cell cortex during metaphase (By similarity). Required for initial activation of CDK1 at centrosomes. Phosphorylates numerous target proteins, including ARHGEF2, BORA, BRCA1, CDC25B, DLGP5, HDAC6, KIF2A, LATS2, NDEL1, PARD3, PPP1R2, PLK1, RASSF1, TACC3, p53/TP53 and TPX2. Regulates KIF2A tubulin depolymerase activity. Required for normal axon formation. Plays a role in microtubule remodeling during neurite extension. Important for microtubule formation and/or stabilization. Also acts as a key regulatory component of the p53/TP53 pathway, and particularly the checkpoint-response pathways critical for oncogenic transformation of cells, by phosphorylating and stabilizing p53/TP53. Phosphorylates its own inhibitors, the protein phosphatase type 1 (PP1) isoforms, to inhibit their activity. Necessary for proper cilia disassembly prior to mitosis.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...