Pdpk1 (NM_001080773) Mouse Untagged Clone

CAT#: MC217433

Pdpk1 (untagged) - Mouse 3-phosphoinositide dependent protein kinase 1 (Pdpk1), transcript variant 2, (10ug)



  "NM_001080773" in other vectors (4)

CNY 6,750.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
PDPK1 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Pdk1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217433 representing NM_001080773
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGGACCACCAGCCAGCTGTATGACGCTGTGCCCATTCAGTCCAGTGTGGTGCTATGTTCCTGCC
CATCCCCATCAATGGTGAGGTCCCAGACTGAGCCCGGTTCGTCCCCTGGCATTCCTAGTGGTGTTAGCAG
GCAGGGATCCACCATGGATGGCACCACAGCTGAAGCCCGACCAAGCACCAACCCCTTGCAGCAGCACCCT
GCCCAGCTGCCACCACAGCCTCGCAAGAAACGCCCTGAAGACTTCAAGTTTGGGAAAATTCTTGGCGAGG
GCTCTTTTTCAACAGTTGTTCTGGCCCGAGAACTGGCCACTTCCAGAGAATATGCTATTAAAATTCTGGA
GAAACGTCATATTATAAAAGAAAACAAAGTTCCGTATGTAACTAGAGAGAGAGATGTGATGTCACGCCTG
GATCACCCCTTCTTTGTGAAACTTTATTTTACATTTCAGGACGACGAAAAGCTGTATTTTGGCCTTAGTT
ATGCCAAAAATGGAGAGCTACTTAAATACATCCGCAAAATTGGCTCATTTGATGAGACCTGTACCCGGTT
TTACACGGCTGAGATTGTGTCTGCTTTAGAGTACTTGCATGGCAAGGGCATCATTCACAGAGACCTTAAA
CCAGAAAACATTTTGTTAAATGAAGACATGCACATCCAGATCACAGATTTTGGAACAGCAAAAGTGTTAT
CCCCAGAGAGCAAACAAGCCAGGGCCAACTCATTTGTAGGAACAGCACAGTATGTTTCTCCAGAGCTGCT
CACAGAGAAGTCGGCGTGTAAAAGTTCAGACCTTTGGGCCCTTGGATGTATAATCTATCAGCTCGTGGCA
GGACTCCCACCATTCAGAGCCGGGAATGAATATCTTATATTTCAGAAGATCATTAAGCTGGAATATCATT
TCCCAGAAAAATTCTTCCCTAAGGCTAGAGATCTTGTGGAAAAACTCTTGGTTTTAGATGCCACAAAGCG
TTTAGGCTGTGAAGAGATGGAAGGGTACGGGCCTCTCAAAGCTCATCCATTCTTTGAGACCATCACTTGG
GAGAATTTGCACCAGCAGACACCTCCGAAGCTCACAGCTTACCTACCAGCCATGTCAGAGGATGATGAAG
ACTGCTATGGCAACTACGACAATCTCCTGAGCCAGTTTGGCTTCATGCAGGTGTCATCCTCCTCCTCTTC
CCACTCCCTGTCTACGGTGGAAACCAGCCTGCCCCAGAGGTCGGGCAGCAACATAGAGCAGTACATCCAT
GATTTGGACACTAACTCTTTTGAACTAGACTTACAGTTTTCAGAAGATGAAAAAAGGTTGTTATTGGAAA
AGCAAGCCGGTGGAAACCCTTGGCACCAGTTTGTAGAAAATAATCTAATATTAAAAATGGGTCCAGTGGA
TAAGCGAAAGGGTTTATTTGCAAGACGACGACAGTTATTACTCACAGAAGGGCCACATTTATATTATGTT
GATCCTGTCAACAAGGTCTTGAAAGGTGAAATCCCATGGTCACAAGAACTCCGACCAGAAGCCAAGAATT
TTAAAACTTTCTTTGTCCACACGATGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001080773
Insert Size 1569 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001080773.2, NP_001074242.1
RefSeq Size 1783 bp
RefSeq ORF 1569 bp
Locus ID 18607
Gene Summary Serine/threonine kinase which acts as a master kinase, phosphorylating and activating a subgroup of the AGC family of protein kinases. Its targets include: protein kinase B (PKB/AKT1, PKB/AKT2, PKB/AKT3), p70 ribosomal protein S6 kinase (RPS6KB1), p90 ribosomal protein S6 kinase (RPS6KA1, RPS6KA2 and RPS6KA3), cyclic AMP-dependent protein kinase (PRKACA), protein kinase C (PRKCD and PRKCZ), serum and glucocorticoid-inducible kinase (SGK1, SGK2 and SGK3), p21-activated kinase-1 (PAK1), protein kinase PKN (PKN1 and PKN2). Plays a central role in the transduction of signals from insulin by providing the activating phosphorylation to PKB/AKT1, thus propagating the signal to downstream targets controlling cell proliferation and survival, as well as glucose and amino acid uptake and storage. Negatively regulates the TGF-beta-induced signaling by: modulating the association of SMAD3 and SMAD7 with TGF-beta receptor, phosphorylating SMAD2, SMAD3, SMAD4 and SMAD7, preventing the nuclear translocation of SMAD3 and SMAD4 and the translocation of SMAD7 from the nucleus to the cytoplasm in response to TGF-beta. Activates PPARG transcriptional activity and promotes adipocyte differentiation. Activates the NF-kappa-B pathway via phosphorylation of IKKB. The tyrosine phosphorylated form is crucial for the regulation of focal adhesions by angiotensin II. Controls proliferation, survival, and growth of developing pancreatic cells. Participates in the regulation of Ca(2+) entry and Ca(2+)-activated K(+) channels of mast cells. Essential for the motility of vascular endothelial cells (ECs) and is involved in the regulation of their chemotaxis. Plays a critical role in cardiac homeostasis by serving as a dual effector for cell survival and beta-adrenergic response. Plays an important role during thymocyte development by regulating the expression of key nutrient receptors on the surface of pre-T cells and mediating Notch-induced cell growth and proliferative responses. Provides negative feedback inhibition to toll-like receptor-mediated NF-kappa-B activation in macrophages.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has an alternate splice site in the 3' region, compared to variant 1. The resulting isoform (B) is shorter and has a distinct C-terminus, compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...