Celf2 (NM_001160293) Mouse Untagged Clone

CAT#: MC217419

Celf2 (untagged) - Mouse CUGBP, Elav-like family member 2 (Celf2), transcript variant 8, (10ug)



  "NM_001160293" in other vectors (4)

CNY 6,750.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms B230218O03; B230345P09Rik; C88023; CELF-2; CUG-BP2; Cugbp2; D230046B21Rik; Etr-3; mETR-3; Napor
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217419 representing NM_001160293
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTGAGCGCACTTCTGAACTGGCTTTTGTTGAGACTATCAGTGTAGAAAGCATGCGCTGTCCCAAAT
CCGCTGTTACTATGAGAAATGAGGAGCTGCTTTTAAGTAACGGCACAGCCAACAAGATGAACGGAGCTTT
GGATCATTCAGACCAGCCAGACCCAGATGCCATTAAGATGTTTGTCGGACAGATCCCTAGGTCCTGGTCG
GAAAAGGAGCTGAAAGAACTTTTTGAGCCTTATGGAGCTGTCTACCAGATCAACGTCCTCCGGGACCGGA
GTCAGAACCCTCCCCAGAGTAAAGGTTGTTGTTTCGTAACATTTTATACAAGAAAAGCTGCACTTGAGGC
CCAGAATGCACTGCACAATATTAAAACTTTACCTGGGATGCATCATCCCATTCAGATGAAACCTGCAGAT
AGTGAAAAGTCAAACGCTGTGGAAGACAGAAAATTGTTCATAGGAATGGTTTCCAAGAAATGTAACGAGA
ATGATATCAGAGTGATGTTTTCTCCATTCGGTCAGATAGAAGAATGCCGGATTCTCCGGGGACCTGATGG
GCTGAGTCGAGGCTGTGCGTTTGTCACATTTTCTACAAGGGCAATGGCACAGAATGCAATCAAAGCCATG
CATCAGTCTCAGACCATGGAGGGCTGCTCTTCACCAATCGTGGTGAAGTTTGCTGACACTCAGAAGGACA
AAGAGCAAAGGCGCCTCCAGCAGCAGCTTGCACAGCAGATGCAACAGCTCAACACTGCCACTTGGGGGAA
CCTAACAGGACTGGGTGGACTTACCCCGCAGTACCTGGCGCTTCTGCAGCAGGCCACCTCCTCCAGCAAC
CTGGGTGCATTCAGTGGCATTCAGCAAATGGCTGGCATGAATGCTTTACAGTTACAGAATCTGGCAACAC
TGGCTGCTGCTGCAGCTGCTGCTCAAACCTCAGCCACCAGCACCAATGCAAACCCTCTGTCTAGCACAAG
CAGTGCCCTGGGAGCCCTCACAAGCCCTGTGGCTGCTTCAACCCCCAATTCCACCGCTGGTGCGGCCATG
AATTCCTTGACCTCTCTTGGGACTCTACAAGGATTGGCTGGAGCCACTGTCGGATTGAATAATATTAATG
CACTAGCAGGTATGGCGGCTCTGAATGGAGGACTTGGCGCCACAGGCTTGACGAATGGTACGGCTGGCAC
CATGGACGCCCTGACCCAGGCCTACTCAGGAATTCAGCAGTATGCGGCAGCTGCACTGCCCACTTTGTAC
AGCCAGAGCTTGCTGCAACAGCAGAGTGCTGCAGGCAGCCAGAAGGAAGGTCCAGAGGGGGCAAACCTCT
TTATTTACCACCTTCCACAGGAGTTTGGAGACCAGGACATTCTGCAGATGTTCATGCCCTTTGGAAATGT
TATCTCTGCTAAAGTCTTCATTGACAAACAGACCAATCTGAGCAAGTGCTTTGGTTTTGTTAGCTATGAC
AATCCAGTCTCTGCACAAGCTGCAATCCAGGCTATGAACGGCTTTCAGATCGGCATGAAACGCTTGAAGG
TGCAGCTGAAACGCTCCAAAAACGACAGCAAACCTTACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001160293
Insert Size 1581 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001160293.1, NP_001153765.1
RefSeq Size 8766 bp
RefSeq ORF 1581 bp
Locus ID 14007
UniProt ID Q9Z0H4
Gene Summary RNA-binding protein implicated in the regulation of several post-transcriptional events. Involved in pre-mRNA alternative splicing, mRNA translation and stability. Mediates exon inclusion and/or exclusion in pre-mRNA that are subject to tissue-specific and developmentally regulated alternative splicing (By similarity). Specifically activates exon 5 inclusion of TNNT2 in embryonic, but not adult, skeletal muscle (By similarity). Activates TNNT2 exon 5 inclusion by antagonizing the repressive effect of PTB (By similarity). Acts as both an activator and repressor of a pair of coregulated exons: promotes inclusion of the smooth muscle (SM) exon but exclusion of the non-muscle (NM) exon in actinin pre-mRNAs (By similarity). Promotes inclusion of exonS 21 and exclusion of exon 5 of the NMDA receptor R1 pre-mRNA (By similarity). Involved in the apoB RNA editing activity (By similarity). Increases COX2 mRNA stability and inhibits COX2 mRNA translation in epithelial cells after radiation injury. Modulates the cellular apoptosis program by regulating COX2-mediated prostaglandin E2 (PGE2) expression. Binds to (CUG)n triplet repeats in the 3' UTR of transcripts such as DMPK (By similarity). Binds to the muscle-specific splicing enhancer (MSE) intronic sites flanking the TNNT2 alternative exon 5 (By similarity). Binds preferentially to UG-rich sequences, in particular UG repeat and UGUU motifs (By similarity). Binds to apoB mRNA, specifically to AU-rich sequences located immediatly upstream of the edited cytidine (By similarity). Binds AU-rich sequences in the 3' UTR of COX2 mRNA. Binds to an intronic RNA element responsible for the silencing of exon 21 splicing. Binds to (CUG)n repeats. May be a specific regulator of miRNA biogenesis. Binds to primary microRNA pri-MIR140 and, with CELF1, negatively regulates the processing to mature miRNA (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (8) differs in the 3' UTR, compared to variant 1. Both variants 1 and 8 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...