Htr2b (NM_008311) Mouse Untagged Clone

CAT#: MC216631

Htr2b (untagged) - Mouse 5-hydroxytryptamine (serotonin) receptor 2B (Htr2b), (10ug)



  "NM_008311" in other vectors (4)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
HTR2B Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5-HT2B; AJ012488; AV377389
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216631 representing NM_008311
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTCATCTTATAAAATGTCTGAACAAAGCACAACTTCTGAGCACATTTTACAGAAGACATGTGATC
ACCTGATCCTGACTAACCGTTCTGGATTAGAGACAGACTCAGTAGCAGAGGAAATGAAGCAGACTGTGGA
GGGACAGGGGCATACAGTGCACTGGGCAGCTCTCCTGATACTCGCGGTGATAATACCCACCATTGGTGGG
AACATCCTTGTGATTCTGGCTGTTGCACTGGAGAAAAGGCTGCAGTACGCTACCAACTACTTTTTAATGT
CCTTGGCGATAGCAGATTTGCTGGTTGGATTGTTTGTGATGCCGATTGCCCTCTTGACAATCATGTTTGA
GGCTATATGGCCCCTCCCACTGGCCCTGTGTCCTGCCTGGTTATTCCTCGATGTTCTCTTTTCAACTGCC
TCCATCATGCATCTCTGTGCCATTTCCCTGGACCGCTATATAGCCATCAAAAAGCCAATTCAGGCCAATC
AGTGCAACTCCCGGGCTACTGCATTCATCAAGATTACAGTGGTATGGTTAATTTCAATAGGCATCGCCAT
CCCAGTCCCTATTAAAGGAATCGAGACTGATGTGATTAATCCACACAATGTCACCTGTGAGCTGACAAAG
GACCGCTTTGGCAGTTTTATGGTCTTTGGGTCACTGGCTGCTTTCTTCGCACCTCTCACCATCATGGTAG
TCACTTACTTTCTCACCATTCACACTTTACAGAAGAAAGCTTACTTGGTCAAAAATAAGCCACCTCAACG
CCTAACACGGTGGACTGTGCCCACAGTTTTCCTAAGGGAAGACTCATCCTTTTCATCACCAGAAAAGGTG
GCAATGCTGGATGGGTCTCACAGGGATAAAATTCTACCTAACTCAAGTGATGAGACACTTATGCGAAGAA
TGTCCTCAGTTGGAAAAAGATCAGCCCAAACCATTTCTAATGAGCAGAGAGCCTCGAAGGCCCTTGGAGT
CGTGTTTTTCCTTTTTCTGCTTATGTGGTGCCCCTTTTTTATTACAAATCTAACTTTAGCTCTGTGTGAT
TCCTGCAATCAGACCACTCTCAAAACACTCCTGGAGATATTTGTGTGGATAGGCTACGTTTCCTCGGGGG
TGAATCCTCTGATCTATACACTCTTCAATAAGACATTTCGGGAAGCATTTGGCAGGTACATCACCTGCAA
TTACCGAGCCACAAAGTCAGTAAAAGCACTTAGGAAGTTTTCCAGTACACTTTGTTTTGGGAATTCAATG
GTAGAAAACTCTAAATTTTTCACAAAACATGGAATTCGAAATGGGATCAACCCTGCCATGTACCAGAGCC
CAATGAGGCTCCGAAGTTCAACCATTCAGTCCTCATCAATCATCCTCCTCGATACCCTTCTCACTGAAAA
CGATGGCGACAAAGCGGAAGAGCAGGTCAGCTACATATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008311
Insert Size 1440 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC023690, AAH23690
RefSeq Size 2041 bp
RefSeq ORF 1440 bp
Locus ID 15559
UniProt ID Q02152
Gene Summary G-protein coupled receptor for 5-hydroxytryptamine (serotonin) (PubMed:1426253). Also functions as a receptor for various ergot alkaloid derivatives and psychoactive substances (PubMed:1426253, PubMed:16940156). Ligand binding causes a conformation change that triggers signaling via guanine nucleotide-binding proteins (G proteins) and modulates the activity of downstream effectors. Beta-arrestin family members inhibit signaling via G proteins and mediate activation of alternative signaling pathways. Signaling activates a phosphatidylinositol-calcium second messenger system that modulates the activity of phosphatidylinositol 3-kinase and downstream signaling cascades and promotes the release of Ca(2+) ions from intracellular stores (By similarity). Plays a role in the regulation of dopamine and 5-hydroxytryptamine release, 5-hydroxytryptamine uptake and in the regulation of extracellular dopamine and 5-hydroxytryptamine levels, and thereby affects neural activity (PubMed:16940156, PubMed:18337424). May play a role in the perception of pain (PubMed:21273425). Plays a role in the regulation of behavior, including impulsive behavior (PubMed:21179162). Required for normal proliferation of embryonic cardiac myocytes and normal heart development (PubMed:10944220, PubMed:11413089). Protects cardiomyocytes against apoptosis (PubMed:12738797). Plays a role in the adaptation of pulmonary arteries to chronic hypoxia (PubMed:12244304). Plays a role in vasoconstriction (PubMed:12244304, PubMed:23346101). Required for normal osteoblast function and proliferation, and for maintaining normal bone density (PubMed:17846081). Required for normal proliferation of the interstitial cells of Cajal in the intestine (PubMed:19941613).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...