Hdac1 (NM_008228) Mouse Untagged Clone

CAT#: MC216611

Hdac1 (untagged) - Mouse histone deacetylase 1 (Hdac1), (10ug)



  "NM_008228" in other vectors (6)

CNY 6,270.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
Goat Polyclonal Anti-Hdac1 (aa385-396) Antibody
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms HD1; Hdac1-ps; MommeD5; RPD3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216611 representing NM_008228
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCAGACTCAGGGCACCAAGAGGAAAGTCTGTTACTACTACGACGGGGATGTTGGAAACTACTATT
ATGGACAAGGGCACCCCATGAAGCCTCACCGAATCCGCATGACTCACAATTTGCTGCTCAACTATGGTCT
CTACCGAAAAATGGAGATCTACCGTCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGTGAT
GACTACATTAAATTCCTGCGTTCTATTCGCCCAGATAATATGTCTGAATACAGCAAGCAGATGCAGAGAT
TCAATGTTGGTGAGGACTGTCCGGTGTTTGATGGCTTGTTTGAGTTCTGTCAGTTGTCCACGGGAGGCTC
TGTCGCAAGTGCTGTGAAGCTTAATAAGCAGCAGACGGACATCGCTGTGAACTGGGCCGGGGGCCTGCAC
CATGCAAAGAAGTCTGAAGCTTCTGGCTTCTGTTACGTCAATGACATCGTCCTGGCCATCCTGGAACTGC
TAAAGTACCACCAGAGGGTGCTCTATATTGACATTGATATTCACCATGGCGATGGCGTGGAAGAGGCCTT
CTATACTACAGACCGGGTCATGACTGTGTCCTTTCATAAATACGGAGAGTACTTCCCAGGAACTGGGGAC
CTACGGGACATTGGGGCTGGCAAAGGCAAGTACTATGCTGTGAACTACCCACTGCGAGACGGCATTGACG
ACGAATCCTATGAAGCCATCTTTAAGCCAGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCAGT
GGTCTTACAGTGTGGCTCAGATTCCCTGTCTGGGGACCGGTTAGGTTGCTTCAATCTGACCATCAAAGGA
CACGCCAAGTGTGTGGAGTTCGTGAAGAGTTTCAACTTGCCCATGCTGATGCTGGGAGGAGGTGGCTACA
CCATCCGGAATGTTGCTCGCTGCTGGACTTACGAAACAGCGGTGGCCCTGGACACAGAGATCCCTAATGA
GCTGCCCTACAACGACTACTTTGAATACTTTGGACCGGATTTCAAGCTTCACATCAGCCCTTCCAACATG
ACCAACCAGAACACTAACGAGTACCTGGAGAAGATCAAGCAGCGTCTCTTTGAGAACTTGAGGATGCTGC
CCCATGCCCCTGGGGTCCAGATGCAGGCCATCCCTGAGGATGCCATCCCCGAAGAGAGTGGGGATGAAGA
TGAGGAGGACCCTGACAAACGCATCTCCATCTGCTCCTCTGACAAACGCATTGCCTGTGAGGAAGAGTTC
TCGGACTCAGATGAGGAGGGAGAAGGTGGTCGCAAGAACTCTTCTAACTTCAAAAAAGCCAAAAGAGTTA
AAACAGAGGATGAGAAAGAGAAAGATCCTGAAGAGAAAAAAGAAGTCACAGAAGAAGAGAAAACCAAGGA
GGAGAAGCCAGAAGCCAAAGGGGTCAAAGAAGAGGTCAAGTTGGCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008228
Insert Size 1449 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_008228.2, NP_032254.1
RefSeq Size 1971 bp
RefSeq ORF 1449 bp
Locus ID 433759
UniProt ID O09106
Gene Summary Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Deacetylates SP proteins, SP1 and SP3, and regulates their function. Component of the BRG1-RB1-HDAC1 complex, which negatively regulates the CREST-mediated transcription in resting neurons. Upon calcium stimulation, HDAC1 is released from the complex and CREBBP is recruited, which facilitates transcriptional activation. Deacetylates TSHZ3 and regulates its transcriptional repressor activity. Deacetylates 'Lys-310' in RELA and thereby inhibits the transcriptional activity of NF-kappa-B. Deacetylates NR1D2 and abrogates the effect of KAT5-mediated relieving of NR1D2 transcription repression activity. Component of a RCOR/GFI/KDM1A/HDAC complex that suppresses, via histone deacetylase (HDAC) recruitment, a number of genes implicated in multilineage blood cell development. Involved in CIART-mediated transcriptional repression of the circadian transcriptional activator: CLOCK-ARNTL/BMAL1 heterodimer. Required for the transcriptional repression of circadian target genes, such as PER1, mediated by the large PER complex or CRY1 through histone deacetylation.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...