Ntrk2 (NM_008745) Mouse Untagged Clone

CAT#: MC216473

Ntrk2 (untagged) - Mouse neurotrophic tyrosine kinase, receptor, type 2 (Ntrk2), transcript variant 2, (10ug)



  "NM_008745" in other vectors (4)

CNY 3,656.00

CNY 6,180.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms GP145-TrkB/GP95-TrkB; Tkrb; trk-B; trkB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216473 representing NM_008745
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGCCCTGGCTGAAGTGGCATGGACCCGCCATGGCGCGGCTCTGGGGCTTATGCCTGCTGGTCTTGG
GCTTCTGGAGGGCCTCTCTCGCCTGCCCGACGTCCTGCAAATGCAGTTCCGCTAGGATTTGGTGTACTGA
GCCTTCTCCAGGCATCGTGGCATTCCCGAGGTTGGAACCTAACAGCGTTGACCCGGAGAACATCACGGAA
ATTCTCATTGCAAACCAGAAAAGGCTAGAAATCATCAATGAAGATGACGTTGAAGCTTACGTGGGGCTGA
GAAACCTTACAATTGTGGATTCCGGCTTAAAGTTTGTGGCTTACAAAGCGTTTCTGAAAAACAGCAACCT
GCGGCACATAAATTTCACACGAAACAAGCTGACGAGTTTGTCCAGGAGACATTTCCGCCACCTTGACTTG
TCTGACCTGATCCTGACGGGTAATCCGTTCACGTGCTCCTGCGACATCATGTGGCTCAAGACTCTCCAGG
AGACTAAATCCAGCCCCGACACTCAGGATTTGTACTGCCTCAATGAGAGCAGCAAGAACATGCCCCTGGC
GAACCTGCAGATACCCAATTGTGGTCTGCCATCTGCACGTCTGGCTGCTCCTAACCTCACCGTGGAGGAA
GGAAAGTCTGTGACCCTTTCCTGCAGTGTGGGGGGTGACCCACTCCCCACCTTGTACTGGGACGTTGGGA
ATTTGGTTTCCAAGCACATGAATGAAACAAGCCACACACAGGGCTCCTTAAGGATAACGAACATTTCATC
TGATGACAGTGGAAAGCAAATCTCTTGTGTGGCAGAAAACCTTGTAGGAGAAGATCAAGATTCTGTGAAC
CTCACTGTGCATTTTGCGCCAACTATCACGTTTCTCGAGTCTCCAACCTCAGATCACCACTGGTGCATTC
CATTCACTGTGAGAGGCAACCCCAAGCCTGCGCTTCAGTGGTTCTACAATGGGGCCATACTGAATGAGTC
CAAGTACATCTGTACTAAGATCCACGTCACCAATCACACGGAGTACCATGGCTGCCTCCAGCTGGATAAC
CCCACTCATATGAATAACGGAGACTACACCCTGATGGCCAAGAACGAGTATGGGAAGGATGAGAGACAGA
TCTCCGCTCACTTCATGGGCCGGCCTGGAGTCGACTACGAGACAAACCCAAATTACCCTGAAGTCCTCTA
TGAAGACTGGACCACGCCAACTGACATTGGGGATACTACGAACAAAAGTAATGAAATCCCCTCCACGGAT
GTTGCTGACCAAAGCAATCGGGAGCATCTCTCGGTCTATGCCGTGGTGGTGATTGCATCTGTGGTGGGAT
TCTGCCTGCTGGTGATGTTGCTCCTGCTCAAGTTGGCGAGACATTCCAAGTTTGGCATGAAAGGTTTTGT
TTTGTTTCATAAGATCCCACTGGATGGGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_008745
Insert Size 1431 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC052014, AAH52014
RefSeq Size 2279 bp
RefSeq ORF 1431 bp
Locus ID 18212
UniProt ID P15209
Gene Summary Receptor tyrosine kinase involved in the development and the maturation of the central and the peripheral nervous systems through regulation of neuron survival, proliferation, migration, differentiation, and synapse formation and plasticity. Receptor for BDNF/brain-derived neurotrophic factor and NTF4/neurotrophin-4. Alternatively can also bind NTF3/neurotrophin-3 which is less efficient in activating the receptor but regulates neuron survival through NTRK2. Upon ligand-binding, undergoes homodimerization, autophosphorylation and activation. Recruits, phosphorylates and/or activates several downstream effectors including SHC1, FRS2, SH2B1, SH2B2 and PLCG1 that regulate distinct overlapping signaling cascades. Through SHC1, FRS2, SH2B1, SH2B2 activates the GRB2-Ras-MAPK cascade that regulates for instance neuronal differentiation including neurite outgrowth. Through the same effectors controls the Ras-PI3 kinase-AKT1 signaling cascade that mainly regulates growth and survival. Through PLCG1 and the downstream protein kinase C-regulated pathways controls synaptic plasticity. Thereby, plays a role in learning and memory by regulating both short term synaptic function and long-term potentiation. PLCG1 also leads to NF-Kappa-B activation and the transcription of genes involved in cell survival. Hence, it is able to suppress anoikis, the apoptosis resulting from loss of cell-matrix interactions. Isoform GP95-TRKB may also play a role in neutrophin-dependent calcium signaling in glial cells and mediate communication between neurons and glia.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks several exons and uses an alternate 3'-terminal exon, compared to variant 1. The encoded isoform (b) has a shorter and distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...