Ppara (NM_001113418) Mouse Untagged Clone

CAT#: MC216236

Ppara (untagged) - Mouse peroxisome proliferator activated receptor alpha (Ppara), transcript variant 2, (10ug)



  "NM_001113418" in other vectors (3)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit polyclonal PPAR alpha antibody
    • 100 ug

CNY 8,025.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4933429D07Rik; AW742785; Nr1c1; Ppar; PPAR-alpha; PPARalpha
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001113418, the custom clone sequence may differ by one or more nucleotides


ATGGTGGACACAGAGAGCCCCATCTGTCCTCTCTCCCCACTGGAGGCAGATGACCTGGAAAGTCCCTTAT
CTGAAGAATTCTTACAAGAAATGGGAAACATTCAAGAGATTTCTCAGTCCATCGGTGAGGAGAGCTCTGG
AAGCTTTGGTTTTGCAGACTACCAGTACTTAGGAAGCTGTCCGGGCTCCGAGGGCTCTGTCATCACAGAC
ACCCTCTCTCCAGCTTCCAGCCCTTCCTCAGTCAGCTGCCCCGTGATCCCCGCCAGCACGGACGAGTCCC
CCGGCAGTGCCCTGAACATCGAGTGTCGAATATGTGGGGACAAGGCCTCAGGGTACCACTACGGAGTTCA
CGCATGTGAAGGCTGTAAGGGCTTCTTTCGGCGAACTATTCGGCTGAAGCTGGTGTACGACAAGTGTGAT
CGGAGCTGCAAGATTCAGAAGAAGAACCGGAACAAATGCCAGTACTGCCGTTTTCACAAGTGCCTGTCTG
TCGGGATGTCACACAATGCAATTCGCTTTGGAAGAATGCCAAGATCTGAAAAAGCAAAACTGAAAGCAGA
AATTCTTACCTGTGAACACGACCTGAAAGATTCGGAAACTGCAGACCTCAAATCTCTGGGCAAGAGAATC
CACGAAGCCTACCTGAAGAACTTCAACATGAACAAGGTCAAGGCCCGGGTCATACTCGCGGGAAAGACCA
GCAACAACCCGCCTTTTGTCATACATGACATGGAGACCTTGTGTATGGCCGAGAAGACGCTTGTGGCCAA
GATGGTGGCCAACGGCGTCGAAGACAAAGAGGCAGAGGTCCGATTCTTCCACTGCTGCCAGTGCATGTCC
GTGGAGACCGTCACGGAGCTCACAGAATTTGCCAAGGCTATCCCAGGCTTTGCAAACTTGGACTTGAACG
ACCAAGTCACCTTGCTAAAGTACGGTGTGTATGAAGCCATCTTCACGATGCTGTCCTCCTTGATGAACAA
AGACGGGATGCTGATCGCGTACGGCAATGGCTTTATCACACGCGAGTTCCTTAAGAACCTGAGGAAGCCG
TTCTGTGACATCATGGAACCCAAGTTTGACTTCGCTATGAAGTTCAATGCCTTAGAACTGGATGACAGTG
ACATTTCCCTGTTTGTGGCTGCTATAATTTGCTGTGGAGATCGGCCTGGCCTTCTAAACATAGGCTACAT
TGAGAAGTTGCAGGAGGGGATTGTGCACGTGCTTAAGCTCCACCTGCAGAGCAACCATCCAGATGACACC
TTCCTCTTCCCAAAGCTCCTTCAAAAAATGGTGGACCTTCGGCAGCTGGTCACGGAGCATGCGCAGCTCG
TACAGGTCATCAAGAAGACCGAGTCCGACGCAGCGCTGCACCCACTGTTGCAAGAGATCTACAGAGACAT
GTACTGA


Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001113418
Insert Size 1407 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC016892, AAH16892
RefSeq Size 2336 bp
RefSeq ORF 1407 bp
Locus ID 19013
UniProt ID P23204
Gene Summary Ligand-activated transcription factor. Key regulator of lipid metabolism. Activated by the endogenous ligand 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (16:0/18:1-GPC). Activated by oleylethanolamide, a naturally occurring lipid that regulates satiety. Receptor for peroxisome proliferators such as hypolipidemic drugs and fatty acids. Regulates the peroxisomal beta-oxidation pathway of fatty acids. Functions as transcription activator for the ACOX1 and P450 genes. Transactivation activity requires heterodimerization with RXRA and is antagonized by NR2C2. May be required for the propagation of clock information to metabolic pathways regulated by PER2.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and orthologous data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...