Pdk1 (NM_172665) Mouse Untagged Clone

CAT#: MC215702

Pdk1 (untagged) - Mouse pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1), nuclear gene encoding mitochondrial protein, (10ug)



  "NM_172665" in other vectors (6)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
PDK1 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms B830012B01; D530020C15Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_172665, the custom clone sequence may differ by one or more nucleotides


ATGAGGCTGGCAAGGCTGCTGCGGGGCGGCACGAGCGTCAGGCCGCTCTGCGCCGTCCCCTGCGCCAGCC
GTAGCCTGGCCTCGGCCTCGGGTTCCGGGCCGGCGTCGGAGCTTGGCGTTCCGGGCCAGGTGGACTTCTA
TGCGCGCTTCTCGCCGTCGCCACTCTCCATGAAGCAGTTCCTGGACTTCGGGTCAGTGAATGCTTGTGAA
AAGACCTCGTTTATGTTTCTGCGACAAGAGTTGCCTGTTAGATTGGCAAATATAATGAAAGAAATCAGCC
TTCTCCCCGATAATCTTCTCAGGACCCCATCCGTACAGCTGGTGCAAAGTTGGTATATCCAAAGCCTTCA
GGAGTTGCTTGATTTTAAAGACAAAAGTGCTGAAGATGCTAAAACTATTTATGAATTCACAGACACAGTG
ATAAGGATCAGAAACCGGCACAATGATGTCATTCCCACCATGGCCCAGGGTGTGACTGAATACAAGGAGA
GCTTCGGGGTGGATCCTGTCACCAGCCAAAATGTTCAGTACTTTTTGGATCGATTCTACATGAGTCGCAT
CTCAATTAGAATGCTACTCAACCAGCACTCCTTATTGTTCGGTGGAAAAGGAAGTCCATCTCATCGAAAG
CACATTGGAAGCATAAATCCAAACTGCGACGTGGTGGAGGTCATTAAAGATGGCTATGAGAACGCTAGGC
GGCTTTGTGATTTGTATTATGTTAACTCTCCTGAACTTGAACTTGAAGAACTAAATGCGAAATCACCAGG
ACAGACAATACAAGTGGTTTATGTACCATCCCATCTCTATCACATGGTGTTTGAACTGTTCAAGAATGCC
ATGAGAGCGACCATGGAGCACCACGCGGACAAAGGCGTTTATCCCCCGATTCAGGTTCACGTCACGCTGG
GCGAGGAGGATCTGACTGTGAAGATGAGTGACCGGGGAGGCGGTGTTCCACTGAGGAAGATCGACAGACT
CTTCAACTACATGTACTCAACCGCACCCCGGCCTCGTGTTGAAACGTCCCGTGCTGTGCCCCTGGCTGGG
TTTGGTTACGGATTGCCCATATCACGCCTCTATGCACAGTACTTCCAGGGAGACCTAAAGCTGTATTCCT
TAGAGGGCTACGGGACAGATGCGGTTATCTACATTAAGGCTCTGTCGACAGAATCCGTCGAGAGACTCCC
TGTGTACAATAAAGCCGCCTGGAAGCATTACAAAGCCAACCACGAGGCTGACGACTGGTGTGTGCCCAGC
CGAGAGCCGAAAGATATGACCACATTCCGAAGCTCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_172665
Insert Size 1299 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC027196, AAH27196
RefSeq Size 3269 bp
RefSeq ORF 1305 bp
Locus ID 228026
UniProt ID Q8BFP9
Gene Summary Kinase that plays a key role in regulation of glucose and fatty acid metabolism and homeostasis via phosphorylation of the pyruvate dehydrogenase subunits PDHA1 and PDHA2. This inhibits pyruvate dehydrogenase activity, and thereby regulates metabolite flux through the tricarboxylic acid cycle, down-regulates aerobic respiration and inhibits the formation of acetyl-coenzyme A from pyruvate. Plays an important role in cellular responses to hypoxia and is important for cell proliferation under hypoxia. Protects cells against apoptosis in response to hypoxia and oxidative stress (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...