Rhox3g (NM_001145406) Mouse Untagged Clone
CAT#: MC215142
Rhox3g (untagged) - Mouse reproductive homeobox 3G, pseudogene (Rhox3g-ps), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Rhox3; Rhox3.7; Rhox3f; Rhox3g-ps |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC215142 representing NM_001145406
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACAGCACCCAAGGTACCAAGGTTTTGCCGGCTGAAGAGGGAAGAAATGAGGAAGATGGAGGACAGG TGGAGTCGGCATTGGGAGCCACAGCCGCAAGGGGTAGAGGAAAAGAAGCATTAAATGGAGAGAGTCCCGC CGCTGCTGGCACTGCAGGCCTTGTAGAGGAAGACAGGAACAAGGAAGATGGTGGCACCAAGGGAGGTGAG AAGAATGAGCAGGAAGTGAGGGAGCAGATTCCTGAGCATGTTGAAGGAGAGAGTGACCAGGCTGAAGCGC CAAGGCAGGTGCCACGACGTCGATTGCACCATAGATTCACCCAGTGGCAGCTGGACGAACTGGAGAGAAT TTTCCGGATGAATTATTTTCTCAGTCTAGAAGCAAGAAAACAACTGGCCCGATGGATGGGTGTGAATGAA GCCATAGTGAAGAGATGGTTTCAGAAGAGGAGAGAACAATACAGGTGGTATAAGAGGCTATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001145406 |
Insert Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145406.3, NP_001138878.1 |
RefSeq Size | 590 bp |
RefSeq ORF | 483 bp |
Locus ID | 546294 |
Gene Summary | This gene is a member of the reproductive homeobox X-linked family (Rhox), which forms part of the superfamily of Homeobox transcription factors. Rhox family members are thought to contribute to early embryo development as well as female and male gametogenesis because they are expressed during embryogenesis and in reproductive tissues. In the mouse, this family expanded to form gene clusters categorized into alpha, beta and gamma, depending on chromosomal locations. Rhox3 paralogs are in the alpha cluster and are reported to be more highly expressed in testes compared to ovaries. This protein is missing a portion of the N-terminus compared to other Rhox3 paralogs, so its functional capacity is unclear. [provided by RefSeq, Dec 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221990 | Rhox3g (tGFP-tagged) - Mouse reproductive homeobox 3G pseudogene (Rhox3g-ps), (10ug) |
CNY 2,850.00 |
|
MR221990 | Rhox3g (Myc-DDK-tagged) - Mouse reproductive homeobox 3G, pseudogene (Rhox3g-ps) |
CNY 1,200.00 |
|
MR221990L3 | Lenti ORF clone of Rhox3g (Myc-DDK-tagged) - Mouse reproductive homeobox 3G, pseudogene (Rhox3g-ps) |
CNY 4,750.00 |
|
MR221990L4 | Lenti ORF clone of Rhox3g (mGFP-tagged) - Mouse reproductive homeobox 3G, pseudogene (Rhox3g-ps) |
CNY 4,750.00 |