United States
Germany
Japan
United Kingdom
China
Fndc5 (NM_027402) Mouse Untagged Clone
CAT＃: MC214786
Fndc5 (untagged) - Mouse fibronectin type III domain containing 5 (Fndc5), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1500001L03Rik; AI836596; C87088; P; PeP; Pxp |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC214786 representing NM_027402
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCCCCAGGGCCGTGCGCCTGGCCGCCCCGCGCCGCGCTCCGCCTGTGGCTAGGCTGCGTCTGCTTCG CGCTGGTGCAGGCGGACAGCCCCTCAGCCCCTGTGAACGTGACCGTCCGGCACCTCAAGGCCAACTCTGC CGTGGTCAGCTGGGATGTCCTGGAGGATGAAGTGGTCATTGGCTTTGCCATCTCTCAGCAGAAGAAGGAT GTGCGGATGCTCCGGTTCATTCAGGAGGTGAACACCACCACCCGGTCCTGCGCTCTCTGGGACCTGGAGG AGGACACAGAATATATCGTCCATGTGCAGGCCATCTCCATCCAGGGACAGAGCCCAGCCAGTGAGCCTGT GCTCTTCAAGACCCCGCGCGAGGCTGAAAAGATGGCCTCAAAGAACAAAGATGAGGTGACCATGAAGGAG ATGGGGAGGAACCAGCAGCTGCGAACGGGGGAGGTGCTGATCATTGTTGTGGTCCTCTTCATGTGGGCAG GTGTTATAGCTCTCTTCTGCCGCCAGTATGATATCATCAAGGACAACGAGCCCAATAACAACAAGGAGAA AACCAAGAGCGCATCAGAAACCAGCACACCGGAGCATCAGGGTGGGGGTCTCCTCCGCAGCAAGATATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_027402 |
| Insert Size | 630 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC109184, AAI09185 |
| RefSeq Size | 725 bp |
| RefSeq ORF | 630 bp |
| Locus ID | 384061 |
| UniProt ID | Q8K4Z2 |
| Gene Summary | This gene encodes a type I transmembrane protein containing fibronectin type III repeat. The encoded transmembrane protein undergoes proteolytic processing to generate a soluble hormone named irisin that is secreted into the bloodstream. The expression of this gene followed by the secretion of irisin from skeletal muscle is induced by exercise. The ectopic expression of the encoded protein in mice causes an elevation of irisin in blood and improves metabolic health. [provided by RefSeq, Jul 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG216114 | Fndc5 (tGFP-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5), (10ug) |
CNY 5,200.00 |
|
| MR216114 | Fndc5 (Myc-DDK-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
CNY 3,600.00 |
|
| MR216114L1 | Lenti ORF clone of Fndc5 (Myc-DDK-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
CNY 6,000.00 |
|
| MR216114L2 | Lenti ORF clone of Fndc5 (mGFP-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
CNY 5,890.00 |
|
| MR216114L3 | Lenti ORF clone of Fndc5 (Myc-DDK-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
CNY 5,890.00 |
|
| MR216114L4 | Lenti ORF clone of Fndc5 (mGFP-tagged) - Mouse fibronectin type III domain containing 5 (Fndc5) |
CNY 6,000.00 |
