United States
Germany
Japan
United Kingdom
China
Tafa2 (NM_182807) Mouse Untagged Clone
CAT＃: MC214259
Fam19a2 (untagged) - Mouse family with sequence similarity 19, member A2 (Fam19a2), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 6330575M02; Fam19; Fam19a2; FAM19A2 TAFA-2; Sa; Sam2; Taf; Tafa; Tafa-2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC214259 representing NM_182807
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATCACCAAGATGAATAAGAGATACTTGCAGAAAGCAACACAAGGAAAGCTTCTGATAATTATTTTTA TAGTGACCTTGTGGGGGAAAGCCGTTTCCAGCGCCAACCATCACAAAGCTCACCATGTTAGAACTGGGAC TTGCGAGGTTGTGGCGCTGCACAGATGCTGTAATAAGAACAAGATAGAAGAACGGTCCCAAACGGTCAAG TGCTCCTGCTTCCCTGGGCAGGTGGCAGGCACTACCCGAGCTGCTCCGTCTTGTGTGGATGCATCCATAG TGGAACAAAAGTGGTGGTGTCATATGCAGCCATGCCTGGAGGGAGAGGAATGTAAAGTCCTTCCAGATCG CAAAGGATGGAGCTGTTCCTCTGGAAACAAAGTAAAAACAACTAGGGTAACCCATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_182807 |
| Insert Size | 408 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_182807.3, NP_877959.2 |
| RefSeq Size | 4364 bp |
| RefSeq ORF | 408 bp |
| Locus ID | 268354 |
| UniProt ID | Q7TPG7 |
| Gene Summary | This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200805 | Fam19a2 (tGFP-tagged) - Mouse expressed sequence AI851790 (AI851790) |
CNY 2,850.00 |
|
| MR200805 | Fam19a2 (Myc-DDK-tagged) - Mouse family with sequence similarity 19, member A2 (Fam19a2) |
CNY 1,200.00 |
|
| MR200805L3 | Lenti ORF clone of Fam19a2 (Myc-DDK-tagged) - Mouse family with sequence similarity 19, member A2 (Fam19a2) |
CNY 4,750.00 |
|
| MR200805L4 | Lenti ORF clone of Fam19a2 (mGFP-tagged) - Mouse family with sequence similarity 19, member A2 (Fam19a2) |
CNY 4,750.00 |
