United States
Germany
Japan
United Kingdom
China
Gnat3 (NM_001081143) Mouse Untagged Clone
CAT＃: MC213158
Gnat3 (untagged) - Mouse guanine nucleotide binding protein, alpha transducing 3 (Gnat3), (10ug)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Ggust; Gtn |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC213158 representing NM_001081143
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAAGTGGAATTAGTTCAGAGAGCAAGGAATCAGCCAGAAGGTCCAAAGAACTGGAGAAGAAGCTTC AGGAGGATGCTGAGCGGGATGCAAGAACTGTGAAGTTACTGCTACTAGGAGCAGGTGAATCTGGGAAAAG CACTATTGTTAAACAAATGAAGATCATCCATAAGAATGGTTACAGCAAACAAGAATGCATGGAGTTTAAA GCAGTGATTTACAGTAACACATTGCAGTCCATCCTAGCTATTGTGAAAGCCATGGCTACACTGGGGATTG ATTATGTCAATCCTAGGAGCCGAGAGGACCAAGAACAACTTCACTCAATGGCAAATACACTAGAAGATGG TGATATGACTCCACAGCTGGCTGAAATCATTAAACGACTGTGGGGGGATCCAGGAATCCAAGCCTGCTTT GAAAGGGCATCTGAATACCAGCTCAATGACTCTGCAGCTTACTACCTTAATGACTTAGACAGACTCACAG CCCCTGGGTACGTGCCAAATGAGCAAGATGTTCTACATTCCCGGGTGAAAACCACTGGTATCATTGAAAC TCAATTCTCCTTTAAAGACTTGAACTTCAGAATGTTTGATGTAGGTGGCCAGAGATCAGAGAGAAAAAAA TGGATCCACTGCTTTGAAGGAGTCACCTGCATTATATTTTGCGCAGCGCTAAGTGCCTATGACATGGTGC TTGTAGAAGATGAGGAGGTGAACAGAATGCATGAAAGTCTTCACCTGTTTAACAGCATATGTAATCATAA GTACTTCGCAACCACCTCCATTGTTCTGTTTCTTAACAAGAAAGATCTCTTCCAGGAGAAAGTGGCTAAG GTGCACCTCAGCATTTGCTTTCCAGAATATACTGGACCAAACACATTTGAAGATGCAGGGAACTACATCA AGAACCAGTTTCTAGACCTGAACTTAAAAAAAGAAGATAAGGAAATCTATTCTCACATGACCTGTGCTAC TGACACACAAAATGTCAAATTTGTGTTTGATGCAGTGACAGATATAATAATAAAAGAGAACCTCAAAGAC TGTGGGCTCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001081143 |
| Insert Size | 1065 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001081143.1, NP_001074612.1 |
| RefSeq Size | 1174 bp |
| RefSeq ORF | 1065 bp |
| Locus ID | 242851 |
| UniProt ID | Q3V3I2 |
| Gene Summary | Guanine nucleotide-binding protein (G protein) alpha subunit playing a prominent role in bitter and sweet taste transduction as well as in umami (monosodium glutamate, monopotassium glutamate, and inosine monophosphate) taste transduction. Transduction by this alpha subunit involves coupling of specific cell-surface receptors with a cGMP-phosphodiesterase; Activation of phosphodiesterase lowers intracellular levels of cAMP and cGMP which may open a cyclic nucleotide-suppressible cation channel leading to influx of calcium, ultimately leading to release of neurotransmitter. Indeed, denatonium and strychnine induce transient reduction in cAMP and cGMP in taste tissue, whereas this decrease is inhibited by GNAT3 antibody. Gustducin heterotrimer transduces response to bitter and sweet compounds via regulation of phosphodiesterase for alpha subunit, as well as via activation of phospholipase C for beta and gamma subunits, with ultimate increase inositol trisphosphate and increase of intracellular Calcium. GNAT3 can functionally couple to taste receptors to transmit intracellular signal: receptor heterodimer TAS1R2/TAS1R3 senses sweetness and TAS1R1/TAS1R3 transduces umami taste, whereas the T2R family GPCRs act as bitter sensors. Functions also as lumenal sugar sensors in the gut to control the expression of the Na+-glucose transporter SGLT1 in response to dietaty sugar, as well as the secretion of Glucagon-like peptide-1, GLP-1 and glucose-dependent insulinotropic polypeptide, GIP. Thus, may modulate the gut capacity to absorb sugars, with implications in malabsorption syndromes and diet-related disorders including diabetes and obesity.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG223870 | Gnat3 (tGFP-tagged) - Mouse guanine nucleotide binding protein alpha transducing 3 (Gnat3), (10ug) |
CNY 4,370.00 |
|
| MR223870 | Gnat3 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein, alpha transducing 3 (Gnat3) |
CNY 5,488.00 |
|
| MR223870L3 | Lenti ORF clone of Gnat3 (Myc-DDK-tagged) - Mouse guanine nucleotide binding protein, alpha transducing 3 (Gnat3) |
CNY 5,890.00 |
|
| MR223870L4 | Lenti ORF clone of Gnat3 (mGFP-tagged) - Mouse guanine nucleotide binding protein, alpha transducing 3 (Gnat3) |
CNY 5,890.00 |
