Tor1aip2 (NM_001160180) Mouse Untagged Clone
CAT#: MC213112
Tor1aip2 (untagged) - Mouse torsin A interacting protein 2 (Tor1aip2), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 15kDa; 1110020D10Rik; A130072J07; AA103493; AW060462; AW610675; C77739; Ifrg15; Lull1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC213112 representing NM_001160180
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCTCCGATAATTCACACTGCCCTGATTGTGGGCAGCAGTGGTTCCCTAGTTTAGAACTAGGGCACT GGTTGTACCAAACTGAACTTGTTGAAAATGAATGTTACCAAGTGTTCTTAGACCGTATTAACAGGGCTGA CTACTGCCCTGAGTGTTACCCTGACAATCCTGCTAATAGAAGCCTTGTTCTGCCTTGGTCTTTCCCACTT GAGTGGGCACCTCAAAATCTTACCAGGTGGACCTTTGAAAAAGCTTGCCATCCATTTCTTCTGGGTCCTC CACTGGTTAGAAAAAAGATACATGACTCCAGGGTAGCTGGCTTTAATCCTGCATTACAATTAATTTTGTC CAGAACAGACAAAACCTTAAACAAGAAACTTGGCCAAAGCAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001160180 |
Insert Size | 396 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001160180.1, NP_001153652.1 |
RefSeq Size | 2697 bp |
RefSeq ORF | 396 bp |
Locus ID | 240832 |
UniProt ID | Q9ER81 |
Gene Summary | Required for endoplasmic reticulum integrity. Regulates the distribution of TOR1A between the endoplasmic reticulum and the nuclear envelope as well as induces TOR1A, TOR1B and TOR3A ATPase activity (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) shares a portion of its 5' UTR, but uses a completely different set of coding exons compared to variant 5. Variant 1 encodes a shorter protein (interferon alpha responsive protein), which is distinct from torsin A interacting protein 2). Variants 1-4 encode the same protein (isoform a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG223488 | Tor1aip2 (tGFP-tagged) - Mouse torsin A interacting protein 2 (Tor1aip2) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR223488 | Tor1aip2 (Myc-DDK-tagged) - Mouse torsin A interacting protein 2 (Tor1aip2), transcript variant 1 |
CNY 1,200.00 |
|
MR223488L3 | Lenti ORF clone of Tor1aip2 (Myc-DDK-tagged) - Mouse torsin A interacting protein 2 (Tor1aip2), transcript variant 1 |
CNY 4,750.00 |
|
MR223488L4 | Lenti ORF clone of Tor1aip2 (mGFP-tagged) - Mouse torsin A interacting protein 2 (Tor1aip2), transcript variant 1 |
CNY 4,750.00 |
其它Tor1aip2产品