Ccnb1ip1 (NM_001111119) Mouse Untagged Clone

CAT#: MC213064

Ccnb1ip1 (untagged) - Mouse cyclin B1 interacting protein 1 (Ccnb1ip1), (10ug)



  "NM_001111119" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Ccnb1ip1 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Gm288; Hei10; mei4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC213064 representing NM_001111119
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTTTGTGTGAAGACATGCTGCTTTGCAATTATCGGAAGTGTCGGATCAAGCTCTCTGGTTATGCTT
GGGTCACTGCCTGTTCTCACATCTTCTGCGATCAGCACGGCAGCGGGGAGTTCAGTCGTTCACCAGCGAT
CTGTCCTGCTTGCAACAGTACCCTTTCTGGAAAGCTAGATATTGTTCGAACAGAACTCAGTCCATCAGAG
GAGTACAAAGCTATGGTATTGGCAGGGCTTCGCCCAGAGGTTGTTTTGGACATTAGCTCCCGGGCATTGG
CCTTCTGGACATACCAGGTACACCAGGAGCGTCTCTATCAAGAGTATAATTTCAGCAAGGCCGAGAACCA
CTTAAAACAGATGGAGAAGATGTATATGCAGCAAATACAGAGCAAGAATATAGAATTGACCTCTATGAAA
GGGGAGGTTATTTCCATGAAGAAAGTTCTAGAAGAATACAAGAAAAAGTTTAGTGACATCTCTGAAAAAC
TTATGGAGCGTAATCGCCAGTACCAAAAGCTCCAAGGCCTTTATGATAGCCTTAGGCTAAGAAATATCAC
TATCGCCAGCCAAGAAGGCTCCCTGGAACCAGGTATGATCCCGCAGTCTGGAGTCTTTGGCTTCCCACCA
GGGAATAACTCAAAGTTTTCTTTGGACCATATACCAGTTGGAAATCAAGGTGGTGGAGATGAAGATGTTC
AGTTCAGACCATTTTTTGTGTGTTCTCCCACAGCGCCTGAACCCATTAACAACTTCTTTAGTTTTGCATC
TCCAAGCCATGAAGCAGAGCAGCAAGTCTGCAGCAGGGCCTTTAAAGCAAAAAGAATTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001111119
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001111119.1, NP_001104589.1
RefSeq Size 1508 bp
RefSeq ORF 831 bp
Locus ID 239083
UniProt ID D3Z3K2
Gene Summary Ubiquitin E3 ligase that acts as a limiting factor for crossing-over during meiosis: required during zygonema to limit the colocalization of RNF212 with MutS-gamma-associated recombination sites and thereby establish early differentiation of crossover and non-crossover sites. Later, it is directed by MutL-gamma to stably accumulate at designated crossover sites. Probably promotes the dissociation of RNF212 and MutS-gamma to allow the progression of recombination and the implementation of the final steps of crossing over. Modulates cyclin-B levels and participates in the regulation of cell cycle progression through the G2 phase. Overexpression causes delayed entry into mitosis.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...