Bnip1 (NM_172149) Mouse Untagged Clone

CAT#: MC212729

Bnip1 (untagged) - Mouse BCL2/adenovirus E1B interacting protein 1 (Bnip1), (10ug)



  "NM_172149" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010005M06Rik; 5930429G21Rik; Sec20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212729 representing NM_172149
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCTCCCCAGGATGTCCACGTCCGGATCTGTAACCAAGAGATTGTCAAATTCGACCTAGAGGTGA
AGGCGCTTATCCAGGATATTCGAGATTGTTCTGGACCCTTAAGTGAGCTTACTGAACTGAATACTAAGGT
GAAAGAAAAGTTCCAACAGTTAAAACAGAGGATCCAGGAGCTCGAACAGTCAGCAAGGGAGCAAGACAAG
GAGTCAGAGAAGCAGCTTCTACTTCAGGAAGTGGAGAACCACAAAAAGCAGATGCTCAGCAACCAGACCT
CATGGCGAAAAGCCAATCTTACCTGCAAGCTTGCCATCGACAACCTGGAGAAGGCAGAACTTCTGCAAGG
AGGAGACTCCTTACGGCAAAGGAAAACCACCAAAGAGAGTTTGGCCCAGACCTCCAGCTCCATCACAGAG
AGTCTCATGGGGATCAGCAGGATGATGTCACAGCAGGTGCAACAGAGCGAGGAGGCTATGCAGACTCTAG
TCAGCTCCTCACGGACTCTCCTGGATGCAAACGAAGAGTTTAAGTCCATGTCGGGAACCATCCAGTTGGG
CCGGAAGCTCATCACAAAGTACAACCGCCGAGAACTGACGGACAAGCTGCTCATCTTCCTGGCCCTGGCC
CTCTTCCTCGCTACAGTCCTTTATATTGTGAAAAAGCGCCTCTTTCCATTTTTGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_172149
Insert Size 687 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172149.5, NP_742161.4
RefSeq Size 1100 bp
RefSeq ORF 687 bp
Locus ID 224630
UniProt ID Q6QD59
Gene Summary As part of a SNARE complex may be involved in endoplasmic reticulum membranes fusion and be required for the maintenance of endoplasmic reticulum organization. Plays also a role in apoptosis. It is for instance required for endoplasmic reticulum stress-induced apoptosis. As a substrate of RNF185 interacting with SQSTM1, might also be involved in mitochondrial autophagy.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...