Socs2 (NM_001168657) Mouse Untagged Clone
CAT#: MC212638
Socs2 (untagged) - Mouse suppressor of cytokine signaling 2 (Socs2), transcript variant 4, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 8030460M17; AI527257; AW108012; CIS2; Cish2; D130043N08Rik; hg; JAB; SOCS-2; SSI-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212638 representing NM_001168657
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCCTGCGGTGCCTGGAGCCCTCCGGGAATGGAGCGGACAGGACGCGGAGCCAGTGGGGGACCGCGG GGTTGCCGGAGGAACAGTCCCCCGAGGCGGCGCGTCTGGCGAAAGCCCTGCGCGAGCTCAGTCAAACAGG ATGGTACTGGGGAAGTATGACTGTTAATGAAGCCAAAGAGAAATTAAAAGAGGCTCCAGAAGGAACTTTC TTGATTAGAGATAGTTCGCATTCAGACTACCTACTAACTATATCCGTTAAGACGTCAGCTGGACCGACTA ACCTGCGGATTGAGTACCAAGATGGGAAATTCAGATTGGATTCTATCATATGTGTCAAGTCCAAGCTTAA ACAGTTTGACAGTGTGGTTCATCTGATTGACTACTATGTCCAGATGTGCAAGGATAAACGGACAGGCCCA GAAGCCCCACGGAATGGGACTGTTCACCTGTACCTGACCAAACCTCTGTATACATCAGCACCCACTCTGC AGCATTTCTGTCGACTCGCCATTAACAAATGTACCGGTACGATCTGGGGACTGCCTTTACCAACAAGACT AAAAGATTACTTGGAAGAATATAAATTCCAGGTATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001168657 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001168657.1, NP_001162128.1 |
RefSeq Size | 2074 bp |
RefSeq ORF | 597 bp |
Locus ID | 216233 |
UniProt ID | O35717 |
Gene Summary | SOCS family proteins form part of a classical negative feedback system that regulates cytokine signal transduction. SOCS2 appears to be a negative regulator in the growth hormone/IGF1 signaling pathway. Probable substrate recognition component of a SCF-like ECS (Elongin BC-CUL2/5-SOCS-box protein) E3 ubiquitin ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226881 | Socs2 (tGFP-tagged) - Mouse suppressor of cytokine signaling 2 (Socs2) transcript variant 4, (10ug) |
CNY 2,850.00 |
|
MR226881 | Socs2 (Myc-DDK-tagged) - Mouse suppressor of cytokine signaling 2 (Socs2), transcript variant 4 |
CNY 2,400.00 |
|
MR226881L3 | Lenti ORF clone of Socs2 (Myc-DDK-tagged) - Mouse suppressor of cytokine signaling 2 (Socs2), transcript variant 4 |
CNY 4,750.00 |
|
MR226881L4 | Lenti ORF clone of Socs2 (mGFP-tagged) - Mouse suppressor of cytokine signaling 2 (Socs2), transcript variant 4 |
CNY 4,750.00 |