Acer1 (NM_175731) Mouse Untagged Clone

CAT#: MC212348

Acer1 (untagged) - Mouse alkaline ceramidase 1 (Acer1), (10ug)



  "NM_175731" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310024P18Rik; AI662009; Alkcdase1; Asah3; Cer1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212348 representing NM_175731
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCATGTACCGGGCACCAGAGCAAAGATGTCCAGCATCTTTGCCTATCAGAGTTCTGAGGTGGATTGGT
GTGAGAGTAATTTCCAGCACTCAGAGTTGGTGGCCGAGTTCTACAATACGTTCAGCAATGTGTTCTTCCT
CATCTTTGGACCCCTCATGATGTTCCTCATGCATCCGTATGCCCAGAAGCGTACCCGGTGTTTCTATGGA
GTGTCAGTCCTCTTCATGCTCATAGGTCTGTTCTCCATGTATTTCCACATGACACTCAGCTTTCTGGGAC
AGCTGCTGGATGAGATCTCCATCCTGTGGTTGTTGGCCAGTGGATACAGTGTGTGGCTGCCCCGTTGCTA
TTTTCCCAAGTTCGTCAAGGGGAACAGGTTCTACTTCAGCTGCCTGGTAACTATAACCACTATTATCAGC
ACCTTCTTGACGTTCGTGAAGCCCACAGTCAATGCATATGCTCTCAACAGCATCGCCATCCACATCCTCT
ACATTGTGCGCACAGAGTACAAGAAGATTAGGGATGATGATCTTCGGCATCTGATTGCGGTTTCTGTGGT
CTTATGGGCCGCTGCACTGACCAGCTGGATCAGTGACCGTGTACTTTGCAGCTTCTGGCAGCGGATTCAC
TTCTACTACCTGCACAGCATTTGGCACGTCCTCATAAGCATCACATTTCCTTATGGTATCGTGACCATGG
CCCTGGTGGATGCAAAGTATGAGATGCCAGATAAAACCCTCAAAGTCCACTACTGGCCCCGGGACAGCTG
GGTCATCGGGCTACCCTATGTGGAGATCCAGGAGAATGACAAGAACTGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_175731
Insert Size 822 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_175731.4, NP_783858.1
RefSeq Size 2429 bp
RefSeq ORF 822 bp
Locus ID 171168
UniProt ID Q8R4X1
Gene Summary Endoplasmic reticulum ceramidase that catalyzes the hydrolysis of ceramides into sphingosine and free fatty acids at alkaline pH (PubMed:12783875). Ceramides, sphingosine, and its phosphorylated form sphingosine-1-phosphate are bioactive lipids that mediate cellular signaling pathways regulating several biological processes including cell proliferation, apoptosis and differentiation (PubMed:12783875). Exhibits a strong substrate specificity towards the natural stereoisomer of ceramides with D-erythro-sphingosine as a backbone and has a higher activity towards very long-chain unsaturated fatty acids like the C24:1-ceramide (PubMed:12783875). May also hydrolyze dihydroceramides to produce dihydrosphingosine (By similarity). ACER1 is a skin-specific ceramidase that regulates the levels of ceramides, sphingosine and sphingosine-1-phosphate in the epidermis, mediates the calcium-induced differentiation of epidermal keratinocytes and more generally plays an important role in skin homeostasis (PubMed:27126290, PubMed:29056331).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...