Babam2 (NM_181281) Mouse Untagged Clone

CAT#: MC212158

Bre (untagged) - Mouse brain and reproductive organ-expressed protein (Bre), transcript variant 3, (10ug)



  "NM_181281" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 6030405P19Rik; AI429776; B830038C02Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212158 representing NM_181281
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGTGCCTGTAGGGACATAATTTTCAATGCTCAGTACCCAGAGCTGCCTCCTGATTTCATCTTTGGAG
AGGATGCTGAGTTTCTGCCAGACCCCTCTGCGCTGCACAACCTTGCCTCCTGGAACCCTTCAAACCCTGA
GTGCCTGTTGCTCGTGGTGAAGGAGCTGGTGCAGCAGTACCACCAGTTCCAGTGCGGCCGCCTCCGTGAG
AGCTCGCGCCTCATGTTTGAGTACCAGACGCTCCTGGAAGAGCCTCAGTATGGAGAGAACATGGAAATTT
ATGCTGGAAAGAAAAACAACTGGACTGGTGAATTTTCAGCTCGTTTTCTATTGAAGTTACCAGTAGATTT
CAGCAACATTCCCACATACCTTCTCAAGGATGTAAATGAAGACCCTGGAGAAGATGTGGCCCTTCTTTCT
GTCAGTTTTGAGGATACTGAAGCTACCCAGGTGTACCCCAAGTTGTACTTGTCACCCCGAATTGAGCATG
CACTCGGAGGCTCCTCTGCTCTTCACATCCCTGCTTTCCCCGGAGGAGGATGTCTCATTGATTATGTGCC
TCAAGTGTGCCACCTGCTCACCAACAAGGTACAGTATGTGATTCAAGGCTATCACAAAAGAAGAGAGTAC
ATCGCAGCTTTCCTCAGTCACTTTGGCACAGGTGTCGTGGAATATGATGCAGAAGGCTTCACAAAACTTA
CTCTGCTGCTGATGTGGAAAGACTTTTGTTTTCTTGTCCACATTGACCTGCCCCTGTTTTTCCCTCGAGA
TCAGCCTACGCTCACATTTCAGTCAGTCTATCACTTTACCAACAGTGGACAGCTTTACTCCCAAGCACAA
AAAAACTACCCATACAGCCCCAGATGGGATGGAAATGAAATGGCCAAGAGAGCAAAGGCTTATTTCAAAA
CCTTTGTCCCTCAGTTCCAGGAGGCCGCATTTGCCAATGGAAAGCTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_181281
Insert Size 960 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181281.1, NP_851798.1
RefSeq Size 1143 bp
RefSeq ORF 960 bp
Locus ID 107976
UniProt ID Q8K3W0
Gene Summary Component of the BRCA1-A complex, a complex that specifically recognizes 'Lys-63'-linked ubiquitinated histones H2A and H2AX at DNA lesions sites, leading to target the BRCA1-BARD1 heterodimer to sites of DNA damage at double-strand breaks (DSBs). The BRCA1-A complex also possesses deubiquitinase activity that specifically removes 'Lys-63'-linked ubiquitin on histones H2A and H2AX. In the BRCA1-A complex, it acts as an adapter that bridges the interaction between BABAM1/NBA1 and the rest of the complex, thereby being required for the complex integrity and modulating the E3 ubiquitin ligase activity of the BRCA1-BARD1 heterodimer. Probably also plays a role as a component of the BRISC complex, a multiprotein complex that specifically cleaves 'Lys-63'-linked ubiquitin (By similarity). May regulate TNF-alpha signaling through its interactions with TNFRSF1A.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...