Uqcc3 (NM_001160356) Mouse Untagged Clone
CAT#: MC212138
AI462493 (untagged) - Mouse expressed sequence AI462493 (AI462493), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI462493; Cbp4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212138 representing NM_001160356
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGTGGCTCGTAAAGCACTTGTGGCAGTTGCAGTGCTAGGCGGGGGAGCTGGCGTGGGTTCTATTC TGTTTGCTCTTGTGACCCCAGGAGAACTACAGAAGCAGTCGATGCTGCAGGAGATGCCGGAAAGGGACTC GCGGCGCAGGGACGAAGCAGTCAGGACCACGGAACTGGTGATGGCTACCCTGAAGGACGCCGCAGCCACG AAGGAGAACGTGGCCTGGAGGAGAAACTGGACAGTTAGCGGGGATGGCAGGTCAGCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001160356 |
Insert Size | 270 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001160356.1, NP_001153828.1 |
RefSeq Size | 847 bp |
RefSeq ORF | 270 bp |
Locus ID | 107197 |
UniProt ID | Q8K2T4 |
Gene Summary | Required for the assembly of the ubiquinol-cytochrome c reductase complex (mitochondrial respiratory chain complex III or cytochrome b-c1 complex), mediating cytochrome b recruitment and probably stabilization within the complex. Thereby, plays an important role in ATP production by mitochondria. Cardiolipin-binding protein, it may also control the cardiolipin composition of mitochondria membranes and their morphology.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215494 | AI462493 (tGFP-tagged) - Mouse expressed sequence AI462493 (AI462493), (10ug) |
CNY 2,850.00 |
|
MR215494 | AI462493 (Myc-DDK-tagged) - Mouse expressed sequence AI462493 (AI462493) |
CNY 1,200.00 |
|
MR215494L3 | Lenti ORF clone of AI462493 (Myc-DDK-tagged) - Mouse expressed sequence AI462493 (AI462493) |
CNY 4,750.00 |
|
MR215494L4 | Lenti ORF clone of AI462493 (mGFP-tagged) - Mouse expressed sequence AI462493 (AI462493) |
CNY 4,750.00 |