Tecr (NM_027179) Mouse Untagged Clone

CAT#: MC212125

Tecr (untagged) - Mouse trans-2,3-enoyl-CoA reductase (Tecr), transcript variant 2, (10ug)



  "NM_027179" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2410016D23Rik; A230102P12Rik; AI173355; D17Ertd178e; Gpsn2; SC2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212125 representing NM_027179
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGCACTACGAGGTGGAGATTCGGGATGCAAAGACGAGGGAGAAGCTGTGCTTCCTGGACAAGGTAG
AGCCTCAGGCCACCATTTCTGAAATCAAGACCCTTTTCACCAAGACACAGGGGAAGTCCCTGAAAGATGA
AGATGTCTTACAGAAGCTTCCTGTGGGCACCACAGCCACACTCTACTTCCGGGACCTCGGGGCCCAGATC
AGCTGGGTGACGGTCTTCCTGACGGAGTATGCCGGGCCCCTTTTCATCTACCTGCTCTTCTACTTCCGGG
TACCCTTCATTTATGGCCGCAAATACGACTTTACGTCCAGTCGGCATACGGTGGTGCACCTCGCCTGCAT
GTGCCACTCGTTCCACTACATCAAGCGCCTGCTGGAGACTCTCTTCGTGCACCGATTCTCTCACGGAACC
ATGCCTTTGCGAAACATCTTCAAAAACTGCACCTACTATTGGGGCTTTGCTGCATGGATGGCTTATTACA
TCAACCACCCTCTCTACACACCCCCTACCTATGGAGTTCAGCAGGTTAAGCTGGCACTGGCCGTTTTTGT
GATCTGCCAGCTTGGGAACTTCTCCATCCACATGGCTCTTCGGGACCTTCGGCCTGCTGGGTCGAAAACC
AGGAAGATCCCATACCCCACCAAGAACCCCTTCACCTGGCTGTTCCTGTTGGTGTCCTGTCCCAACTACA
CTTATGAGGTGGGCTCCTGGATTGGCTTTGCCATCTTGACTCAGTGTGTCCCAGTGGCCCTCTTCTCCCT
GGTGGGCTTCACCCAGATGACTATCTGGGCCAAGGGCAAACACCGCAGCTACCTGAAGGAGTTCCGCGAC
TACCCGCCCCTGCGCATGCCCATTATTCCCTTCCTGCTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_027179
Insert Size 882 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_027179.1, NP_081455.1
RefSeq Size 1145 bp
RefSeq ORF 882 bp
Locus ID 106529
UniProt ID Q9CY27
Gene Summary Involved in both the production of very long-chain fatty acids for sphingolipid synthesis and the degradation of the sphingosine moiety in sphingolipids through the sphingosine 1-phosphate metabolic pathway (By similarity). Catalyzes the last of the four reactions of the long-chain fatty acids elongation cycle (By similarity). This endoplasmic reticulum-bound enzymatic process, allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids/VLCFAs per cycle (By similarity). This enzyme reduces the trans-2,3-enoyl-CoA fatty acid intermediate to an acyl-CoA that can be further elongated by entering a new cycle of elongation (By similarity). Thereby, it participates in the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators (By similarity). Catalyzes the saturation step of the sphingosine 1-phosphate metabolic pathway, the conversion of trans-2-hexadecenoyl-CoA to palmitoyl-CoA (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...