1700028K03Rik (NM_182745) Mouse Untagged Clone

CAT#: MC211736

1700028K03Rik (untagged) - Mouse RIKEN cDNA 1700028K03 gene (1700028K03Rik), transcript variant 1, (10ug)



  "NM_182745" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
C1orf146 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MGC117884
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211736 representing NM_182745
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAATGGATGAGCGTAGAGGAAAAGAAAGAGTACAGTGGACAACCACCATTATTATCAGCTCATCTC
TTAAGAGTTACGAAATTGCAACTGCCCTAGAAAATCGAAGCCACAAGGTTCGGTATTCTGATACACTGGA
AAGTGGATCGATTGTATTTTCTCTGTCTGGAGTTGCATTCTTGTTGATGGATGCTAAGGAGTGTATGACA
TCGGCTGAGGAAATATTTGTAACCAAAATTGAGAAGTTTATTAACATTCACCAAAATAGTTTCTTGGTTC
TATTTGCTCCACTCCATGGGCCTGAAGAATGGAGTCTCATGTTCAGGATACATCAGAGGTTCTTGGGCAG
TAACTTACGAATACTTCCTGTACACAACACAGTAAACGCTCTTGACCTTATGTGCACTATAGCCAAGACT
ACGTCCAAACCACACATAGACAGCATCTGCTACAGAATGATAACAACTAAAGCGTACATCATAGAGCAGA
GCCCTGTCTGGAGAACACTTCAAAAGATAAAGTTGAGTAGTGACTCAGTTAGTGCAGACTCAGGAGAGTG
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_182745
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_182745.2, NP_877422.1
RefSeq Size 795 bp
RefSeq ORF 561 bp
Locus ID 76421
UniProt ID Q3KQP7
Gene Summary Plays a key role in reinforcing the integrity of the central element of the synaptonemal complex (SC) thereby stabilizing SC, ensuring progression of meiotic prophase I in male and female germ cells (PubMed:30949703). Promotes homologous recombination and crossing-over in meiotic prophase I via its association with SHOC1 (PubMed:30746471). Required for the localization of TEX11 and MSH4 to recombination intermediates (PubMed:30746471).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...