1700028K03Rik (NM_175241) Mouse Untagged Clone
CAT#: MC211735
1700028K03Rik (untagged) - Mouse RIKEN cDNA 1700028K03 gene (1700028K03Rik), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MGC117884 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211735 representing NM_175241
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAATGGATGAGCGTAGAGGAAAAGAAAGAGTACAGTGGACAACCACCATTATTATCAGCTCATCTC TTAAGAGTTACGAAATTGCAACTGCCCTAGAAAATCGAAGCCACAAGGTTCGGTATTCTGATACACTGGA AAGTGGATCGATTGTATTTTCTCTGTCTGGAGTTGCATTCTTGTTGATGGATGCTAAGGAGTGTATGACA TCGGCTGAGGAAATATTTGTAACCAAAATTGAGAAGTTTATTAACATTCACCAAAATAGTTTCTTGGTTC TATTTGCTCCACTCCATGGGCCTGAAGAATGGAGTCTCATGTTCAGGATACATCAGAGGTTCTTGGGCAG TAACTTACGAATACTTCCTGTACACAACACAGTAAACGCTCTTGACCTTATGTGCACTATAGCCAAGACT ACGTCCAAACCACACATAGACAGCATCTGCTACAGAATGATAACAACTAAAGCGTACATCATAGAGCAGA GCCCTGTCTGGAGAACACTTCAAAAGATAAAAGGTAGACTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_175241 |
Insert Size | 534 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_175241.1, NP_780450.1 |
RefSeq Size | 3096 bp |
RefSeq ORF | 534 bp |
Locus ID | 76421 |
Gene Summary | Plays a key role in reinforcing the integrity of the central element of the synaptonemal complex (SC) thereby stabilizing SC, ensuring progression of meiotic prophase I in male and female germ cells (PubMed:30949703). Promotes homologous recombination and crossing-over in meiotic prophase I via its association with SHOC1 (PubMed:30746471). Required for the localization of TEX11 and MSH4 to recombination intermediates (PubMed:30746471).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has an alternate 3' sequence, as compared to variant 1. The resulting isoform (2) is shorter and has a different C-terminus, as compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG215013 | 1700028K03Rik (tGFP-tagged) - Mouse RIKEN cDNA 1700028K03 gene (1700028K03Rik) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
MR215013 | 1700028K03Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1700028K03 gene (1700028K03Rik), transcript variant 2 |
CNY 1,900.00 |
|
MR215013L3 | Lenti ORF clone of 1700028K03Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1700028K03 gene (1700028K03Rik), transcript variant 2 |
CNY 3,800.00 |
|
MR215013L4 | Lenti ORF clone of 1700028K03Rik (mGFP-tagged) - Mouse RIKEN cDNA 1700028K03 gene (1700028K03Rik), transcript variant 2 |
CNY 3,800.00 |
其它1700028K03Rik产品